\
| Variant ID: vg0726108448 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26108448 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 236. )
TTCCTAGTATGCTTTTTGATTGCCAAAAATCAGTCAAGGGTTTGATTGTCTAGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGTTAAGTTTGAT[C/A]
TACTAAATTCGTGTTTAGAACCATATTTCCTAGCCTGTTTTTTGATTGCCAATAAGGGTTTCATCGGGATTTCAGCCGATGAGTTGTCCCTAGCCTGGTT
AACCAGGCTAGGGACAACTCATCGGCTGAAATCCCGATGAAACCCTTATTGGCAATCAAAAAACAGGCTAGGAAATATGGTTCTAAACACGAATTTAGTA[G/T]
ATCAAACTTAACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCTAGACAATCAAACCCTTGACTGATTTTTGGCAATCAAAAAGCATACTAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.90% | 40.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.50% | 19.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726108448 | C -> A | LOC_Os07g43604.1 | upstream_gene_variant ; 3757.0bp to feature; MODIFIER | silent_mutation | Average:27.049; most accessible tissue: Zhenshan97 young leaf, score: 39.169 | N | N | N | N |
| vg0726108448 | C -> A | LOC_Os07g43610.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.049; most accessible tissue: Zhenshan97 young leaf, score: 39.169 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726108448 | NA | 1.11E-09 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726108448 | NA | 2.73E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726108448 | 3.87E-06 | NA | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726108448 | 2.60E-06 | NA | mr1726_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726108448 | 4.44E-06 | NA | mr1934_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726108448 | 6.82E-06 | NA | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |