\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726065533:

Variant ID: vg0726065533 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26065533
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTGGATGAGACATCCTAGTGATAGGAATCTAAATAGAGAGCCTCTTCAGAATTTTAGTACTAGAATATATTTCATCCAACTAAAATCTTTTATATTTT[C/T]
GGATGGATGGAGTAGAATCAATCTTGTTATGGGACAAGAAGACAAGAAGCTGGATAATAGCAAGGACTTTCTTGTATTGAGGTACATTAATCGCAGTTCC

Reverse complement sequence

GGAACTGCGATTAATGTACCTCAATACAAGAAAGTCCTTGCTATTATCCAGCTTCTTGTCTTCTTGTCCCATAACAAGATTGATTCTACTCCATCCATCC[G/A]
AAAATATAAAAGATTTTAGTTGGATGAAATATATTCTAGTACTAAAATTCTGAAGAGGCTCTCTATTTAGATTCCTATCACTAGGATGTCTCATCCAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.10% 33.80% 0.72% 26.36% NA
All Indica  2759 5.80% 54.50% 1.12% 38.53% NA
All Japonica  1512 96.20% 0.20% 0.07% 3.57% NA
Aus  269 30.10% 25.70% 0.37% 43.87% NA
Indica I  595 8.90% 31.30% 1.18% 58.66% NA
Indica II  465 9.20% 70.50% 1.08% 19.14% NA
Indica III  913 1.30% 64.50% 0.88% 33.30% NA
Indica Intermediate  786 6.60% 51.10% 1.40% 40.84% NA
Temperate Japonica  767 97.10% 0.10% 0.00% 2.74% NA
Tropical Japonica  504 95.00% 0.20% 0.20% 4.56% NA
Japonica Intermediate  241 95.40% 0.40% 0.00% 4.15% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 67.80% 20.00% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726065533 C -> DEL N N silent_mutation Average:42.385; most accessible tissue: Callus, score: 89.061 N N N N
vg0726065533 C -> T LOC_Os07g43570.1 upstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:42.385; most accessible tissue: Callus, score: 89.061 N N N N
vg0726065533 C -> T LOC_Os07g43570-LOC_Os07g43580 intergenic_region ; MODIFIER silent_mutation Average:42.385; most accessible tissue: Callus, score: 89.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726065533 5.03E-08 1.91E-13 mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533 NA 7.22E-07 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533 NA 9.57E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533 NA 6.71E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251