\
| Variant ID: vg0726065533 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26065533 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 73. )
AGTTGGATGAGACATCCTAGTGATAGGAATCTAAATAGAGAGCCTCTTCAGAATTTTAGTACTAGAATATATTTCATCCAACTAAAATCTTTTATATTTT[C/T]
GGATGGATGGAGTAGAATCAATCTTGTTATGGGACAAGAAGACAAGAAGCTGGATAATAGCAAGGACTTTCTTGTATTGAGGTACATTAATCGCAGTTCC
GGAACTGCGATTAATGTACCTCAATACAAGAAAGTCCTTGCTATTATCCAGCTTCTTGTCTTCTTGTCCCATAACAAGATTGATTCTACTCCATCCATCC[G/A]
AAAATATAAAAGATTTTAGTTGGATGAAATATATTCTAGTACTAAAATTCTGAAGAGGCTCTCTATTTAGATTCCTATCACTAGGATGTCTCATCCAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 33.80% | 0.72% | 26.36% | NA |
| All Indica | 2759 | 5.80% | 54.50% | 1.12% | 38.53% | NA |
| All Japonica | 1512 | 96.20% | 0.20% | 0.07% | 3.57% | NA |
| Aus | 269 | 30.10% | 25.70% | 0.37% | 43.87% | NA |
| Indica I | 595 | 8.90% | 31.30% | 1.18% | 58.66% | NA |
| Indica II | 465 | 9.20% | 70.50% | 1.08% | 19.14% | NA |
| Indica III | 913 | 1.30% | 64.50% | 0.88% | 33.30% | NA |
| Indica Intermediate | 786 | 6.60% | 51.10% | 1.40% | 40.84% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 95.00% | 0.20% | 0.20% | 4.56% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.40% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 20.00% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726065533 | C -> DEL | N | N | silent_mutation | Average:42.385; most accessible tissue: Callus, score: 89.061 | N | N | N | N |
| vg0726065533 | C -> T | LOC_Os07g43570.1 | upstream_gene_variant ; 2329.0bp to feature; MODIFIER | silent_mutation | Average:42.385; most accessible tissue: Callus, score: 89.061 | N | N | N | N |
| vg0726065533 | C -> T | LOC_Os07g43570-LOC_Os07g43580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.385; most accessible tissue: Callus, score: 89.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726065533 | 5.03E-08 | 1.91E-13 | mr1004_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726065533 | NA | 7.22E-07 | mr1004_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726065533 | NA | 9.57E-06 | mr1010_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726065533 | NA | 6.71E-06 | mr1013_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |