Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726032754:

Variant ID: vg0726032754 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26032754
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACGTGTTCTGCTGCAGCTGCGGTAAGTCACATATACCACATAGTCACGTACCGGCACCGTGGTATTTGATGGGATATGGATTTTAATACGGGTGGTCCA[C/T]
CCGTTTTTTACATGTCAATTACATGGTTATGAGAAAAAAATTAAAAACTATACAAACATGTAAGTTCAAATTTGATTTCTGTAAGTTGTAACGAAAATAA

Reverse complement sequence

TTATTTTCGTTACAACTTACAGAAATCAAATTTGAACTTACATGTTTGTATAGTTTTTAATTTTTTTCTCATAACCATGTAATTGACATGTAAAAAACGG[G/A]
TGGACCACCCGTATTAAAATCCATATCCCATCAAATACCACGGTGCCGGTACGTGACTATGTGGTATATGTGACTTACCGCAGCTGCAGCAGAACACGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	29.90%	1.10%	3.03%	NA
All Indica	2759	55.40%	42.50%	0.51%	1.59%	NA
All Japonica	1512	89.40%	8.40%	1.98%	0.20%	NA
Aus	269	63.60%	0.70%	0.37%	35.32%	NA
Indica I	595	27.70%	70.60%	0.84%	0.84%	NA
Indica II	465	77.60%	20.60%	0.22%	1.51%	NA
Indica III	913	69.70%	29.20%	0.22%	0.88%	NA
Indica Intermediate	786	46.70%	49.50%	0.76%	3.05%	NA
Temperate Japonica	767	96.60%	1.60%	1.56%	0.26%	NA
Tropical Japonica	504	85.70%	12.30%	1.79%	0.20%	NA
Japonica Intermediate	241	74.30%	22.00%	3.73%	0.00%	NA
VI/Aromatic	96	5.20%	93.80%	1.04%	0.00%	NA
Intermediate	90	66.70%	25.60%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726032754	C -> DEL	N	N	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N
vg0726032754	C -> T	LOC_Os07g43480.1	upstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N
vg0726032754	C -> T	LOC_Os07g43490.1	upstream_gene_variant ; 1453.0bp to feature; MODIFIER	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N
vg0726032754	C -> T	LOC_Os07g43500.1	downstream_gene_variant ; 431.0bp to feature; MODIFIER	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N
vg0726032754	C -> T	LOC_Os07g43510.1	downstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N
vg0726032754	C -> T	LOC_Os07g43490-LOC_Os07g43500	intergenic_region ; MODIFIER	silent_mutation	Average:44.419; most accessible tissue: Callus, score: 75.451	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726032754	4.65E-06	8.72E-07	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	8.09E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	1.65E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	5.92E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	8.17E-06	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	2.81E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	2.48E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	2.87E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	3.93E-14	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	6.12E-11	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754	NA	4.75E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251