\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726032754:

Variant ID: vg0726032754 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26032754
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACGTGTTCTGCTGCAGCTGCGGTAAGTCACATATACCACATAGTCACGTACCGGCACCGTGGTATTTGATGGGATATGGATTTTAATACGGGTGGTCCA[C/T]
CCGTTTTTTACATGTCAATTACATGGTTATGAGAAAAAAATTAAAAACTATACAAACATGTAAGTTCAAATTTGATTTCTGTAAGTTGTAACGAAAATAA

Reverse complement sequence

TTATTTTCGTTACAACTTACAGAAATCAAATTTGAACTTACATGTTTGTATAGTTTTTAATTTTTTTCTCATAACCATGTAATTGACATGTAAAAAACGG[G/A]
TGGACCACCCGTATTAAAATCCATATCCCATCAAATACCACGGTGCCGGTACGTGACTATGTGGTATATGTGACTTACCGCAGCTGCAGCAGAACACGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 29.90% 1.10% 3.03% NA
All Indica  2759 55.40% 42.50% 0.51% 1.59% NA
All Japonica  1512 89.40% 8.40% 1.98% 0.20% NA
Aus  269 63.60% 0.70% 0.37% 35.32% NA
Indica I  595 27.70% 70.60% 0.84% 0.84% NA
Indica II  465 77.60% 20.60% 0.22% 1.51% NA
Indica III  913 69.70% 29.20% 0.22% 0.88% NA
Indica Intermediate  786 46.70% 49.50% 0.76% 3.05% NA
Temperate Japonica  767 96.60% 1.60% 1.56% 0.26% NA
Tropical Japonica  504 85.70% 12.30% 1.79% 0.20% NA
Japonica Intermediate  241 74.30% 22.00% 3.73% 0.00% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 66.70% 25.60% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726032754 C -> DEL N N silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N
vg0726032754 C -> T LOC_Os07g43480.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N
vg0726032754 C -> T LOC_Os07g43490.1 upstream_gene_variant ; 1453.0bp to feature; MODIFIER silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N
vg0726032754 C -> T LOC_Os07g43500.1 downstream_gene_variant ; 431.0bp to feature; MODIFIER silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N
vg0726032754 C -> T LOC_Os07g43510.1 downstream_gene_variant ; 3334.0bp to feature; MODIFIER silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N
vg0726032754 C -> T LOC_Os07g43490-LOC_Os07g43500 intergenic_region ; MODIFIER silent_mutation Average:44.419; most accessible tissue: Callus, score: 75.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726032754 4.65E-06 8.72E-07 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 8.09E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 1.65E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 5.92E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 8.17E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 2.81E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 2.48E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 2.87E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 3.93E-14 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 6.12E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726032754 NA 4.75E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251