\
| Variant ID: vg0726032754 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26032754 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACGTGTTCTGCTGCAGCTGCGGTAAGTCACATATACCACATAGTCACGTACCGGCACCGTGGTATTTGATGGGATATGGATTTTAATACGGGTGGTCCA[C/T]
CCGTTTTTTACATGTCAATTACATGGTTATGAGAAAAAAATTAAAAACTATACAAACATGTAAGTTCAAATTTGATTTCTGTAAGTTGTAACGAAAATAA
TTATTTTCGTTACAACTTACAGAAATCAAATTTGAACTTACATGTTTGTATAGTTTTTAATTTTTTTCTCATAACCATGTAATTGACATGTAAAAAACGG[G/A]
TGGACCACCCGTATTAAAATCCATATCCCATCAAATACCACGGTGCCGGTACGTGACTATGTGGTATATGTGACTTACCGCAGCTGCAGCAGAACACGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 29.90% | 1.10% | 3.03% | NA |
| All Indica | 2759 | 55.40% | 42.50% | 0.51% | 1.59% | NA |
| All Japonica | 1512 | 89.40% | 8.40% | 1.98% | 0.20% | NA |
| Aus | 269 | 63.60% | 0.70% | 0.37% | 35.32% | NA |
| Indica I | 595 | 27.70% | 70.60% | 0.84% | 0.84% | NA |
| Indica II | 465 | 77.60% | 20.60% | 0.22% | 1.51% | NA |
| Indica III | 913 | 69.70% | 29.20% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 46.70% | 49.50% | 0.76% | 3.05% | NA |
| Temperate Japonica | 767 | 96.60% | 1.60% | 1.56% | 0.26% | NA |
| Tropical Japonica | 504 | 85.70% | 12.30% | 1.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 74.30% | 22.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 93.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 25.60% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726032754 | C -> DEL | N | N | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| vg0726032754 | C -> T | LOC_Os07g43480.1 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| vg0726032754 | C -> T | LOC_Os07g43490.1 | upstream_gene_variant ; 1453.0bp to feature; MODIFIER | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| vg0726032754 | C -> T | LOC_Os07g43500.1 | downstream_gene_variant ; 431.0bp to feature; MODIFIER | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| vg0726032754 | C -> T | LOC_Os07g43510.1 | downstream_gene_variant ; 3334.0bp to feature; MODIFIER | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| vg0726032754 | C -> T | LOC_Os07g43490-LOC_Os07g43500 | intergenic_region ; MODIFIER | silent_mutation | Average:44.419; most accessible tissue: Callus, score: 75.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726032754 | 4.65E-06 | 8.72E-07 | mr1116 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 8.09E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 1.65E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 5.92E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 8.17E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 2.81E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 2.48E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 2.87E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 3.93E-14 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 6.12E-11 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726032754 | NA | 4.75E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |