\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725964478:

Variant ID: vg0725964478 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25964478
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.43, G: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGTCCTCTAACTTACGAAACCGTTTAAATAAGTTCCCTCAGCAGTATTTGACCCCGGTTTTAGCTGAGGTGGCGCCTACGTGGCTAATTTGACTCGGT[T/C]
TTCATCTGACGTGGCATTGACGTGGCACTTACGTGGCAATTCGATCCGAAAAATAAAAACCCTATGGGACCCACATGTCAGTTTCACACACATAATTAAA

Reverse complement sequence

TTTAATTATGTGTGTGAAACTGACATGTGGGTCCCATAGGGTTTTTATTTTTCGGATCGAATTGCCACGTAAGTGCCACGTCAATGCCACGTCAGATGAA[A/G]
ACCGAGTCAAATTAGCCACGTAGGCGCCACCTCAGCTAAAACCGGGGTCAAATACTGCTGAGGGAACTTATTTAAACGGTTTCGTAAGTTAGAGGACCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.80% 0.04% 0.00% NA
All Indica  2759 93.80% 6.20% 0.00% 0.00% NA
All Japonica  1512 0.80% 99.10% 0.07% 0.00% NA
Aus  269 60.60% 39.40% 0.00% 0.00% NA
Indica I  595 95.60% 4.40% 0.00% 0.00% NA
Indica II  465 91.00% 9.00% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 31.10% 67.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725964478 T -> C LOC_Os07g43360.1 upstream_gene_variant ; 826.0bp to feature; MODIFIER silent_mutation Average:97.547; most accessible tissue: Minghui63 flower, score: 98.723 N N N N
vg0725964478 T -> C LOC_Os07g43370.1 downstream_gene_variant ; 1591.0bp to feature; MODIFIER silent_mutation Average:97.547; most accessible tissue: Minghui63 flower, score: 98.723 N N N N
vg0725964478 T -> C LOC_Os07g43360-LOC_Os07g43370 intergenic_region ; MODIFIER silent_mutation Average:97.547; most accessible tissue: Minghui63 flower, score: 98.723 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725964478 T C -0.04 -0.04 -0.05 -0.05 -0.06 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725964478 NA 1.71E-25 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 6.20E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 9.59E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 1.18E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 6.30E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 4.59E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 5.44E-07 mr1728 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 2.03E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725964478 NA 1.30E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251