\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725887430:

Variant ID: vg0725887430 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 25887430
Reference Allele: CCTATATATATCCCATGAGAGGGTCGATAlternative Allele: TCTATATATATCCCATGAGAGGGTCGAT,C
Primary Allele: TCTATATATATCCCATGAGA GGGTCGATSecondary Allele: CCTATATATATCCCATGAGA GGGTCGAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAATAAGATATATCCTAGAGATAGAATTCTAGAGATAAAATAGAGATAAATCTACTTTTATTTATACTGTATTTTAAGACTCTATCTCCTATATACT[CCTATATATATCCCATGAGAGGGTCGAT/TCTATATATATCCCATGAGAGGGTCGAT,C]
CTAATATATGAGAAAACATCATAATACAAGAATTAGATTTTTCCACGTGATGATCACCCTCAAGAGCTCCGACGGCGAGCCGGTCGAGGTGACAGAGGCG

Reverse complement sequence

CGCCTCTGTCACCTCGACCGGCTCGCCGTCGGAGCTCTTGAGGGTGATCATCACGTGGAAAAATCTAATTCTTGTATTATGATGTTTTCTCATATATTAG[ATCGACCCTCTCATGGGATATATATAGG/ATCGACCCTCTCATGGGATATATATAGA,G]
AGTATATAGGAGATAGAGTCTTAAAATACAGTATAAATAAAAGTAGATTTATCTCTATTTTATCTCTAGAATTCTATCTCTAGGATATATCTTATTTCTA

Allele Frequencies:

Populations Population SizeFrequency of TCTATATATATCCCATGAGA GGGTCGAT(primary allele) Frequency of CCTATATATATCCCATGAGA GGGTCGAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.60% 48.30% 0.04% 0.00% C: 0.04%
All Indica  2759 85.60% 14.40% 0.07% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 79.20% 20.70% 0.17% 0.00% NA
Indica II  465 91.60% 8.40% 0.00% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 84.70% 15.10% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 98.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 24.40% 73.30% 0.00% 0.00% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43170.1 upstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43200.1 upstream_gene_variant ; 77.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43170.3 upstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43170.2 upstream_gene_variant ; 4871.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43180.1 downstream_gene_variant ; 2410.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43190.1 downstream_gene_variant ; 162.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> TCTATATATATCCCATGAGAGGGTCGAT LOC_Os07g43190-LOC_Os07g43200 intergenic_region ; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43170.1 upstream_gene_variant ; 4872.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43200.1 upstream_gene_variant ; 76.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43170.3 upstream_gene_variant ; 4872.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43170.2 upstream_gene_variant ; 4872.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43180.1 downstream_gene_variant ; 2411.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43190.1 downstream_gene_variant ; 163.0bp to feature; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N
vg0725887430 CCTATATATATCCCATGAGAGGGTCGAT -> C LOC_Os07g43190-LOC_Os07g43200 intergenic_region ; MODIFIER silent_mutation Average:68.113; most accessible tissue: Callus, score: 83.527 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725887430 NA 2.62E-11 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 3.08E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.36E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.30E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 5.53E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 2.63E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 7.41E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 3.55E-28 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.83E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 3.45E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.81E-15 mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 9.41E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.53E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.93E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 7.61E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 2.34E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 8.65E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.51E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 7.45E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 2.20E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 9.92E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 6.68E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 5.47E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.93E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 2.22E-20 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 9.34E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 6.75E-11 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 2.36E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.75E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725887430 NA 1.52E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251