Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725840534:

Variant ID: vg0725840534 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25840534
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTTCTAAGCATTTGAGTATTTGACATATAAAACATGCTTGAAAAACAGAAGTAATATGCAGTCACCCAATAGTATTCACAATCAGAGATTAAGGAATA[C/A]
AAGAATCATCTAACAGGTGCTACACAAATTTGCAGATTTTACTAATTTTCTTCATTTATCTAGCAGTAGTGTAGTACAGTCTATTTTTAGGCTATTGTTT

Reverse complement sequence

AAACAATAGCCTAAAAATAGACTGTACTACACTACTGCTAGATAAATGAAGAAAATTAGTAAAATCTGCAAATTTGTGTAGCACCTGTTAGATGATTCTT[G/T]
TATTCCTTAATCTCTGATTGTGAATACTATTGGGTGACTGCATATTACTTCTGTTTTTCAAGCATGTTTTATATGTCAAATACTCAAATGCTTAGAACAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.30%	1.00%	0.72%	0.00%	NA
All Indica	2759	97.80%	1.30%	0.83%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	92.60%	3.30%	4.09%	0.00%	NA
Indica I	595	97.00%	1.50%	1.51%	0.00%	NA
Indica II	465	96.30%	2.20%	1.51%	0.00%	NA
Indica III	913	98.90%	1.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.10%	1.10%	0.76%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725840534	C -> A	LOC_Os07g43110.1	upstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:22.088; most accessible tissue: Callus, score: 37.763	N	N	N	N
vg0725840534	C -> A	LOC_Os07g43130.1	downstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:22.088; most accessible tissue: Callus, score: 37.763	N	N	N	N
vg0725840534	C -> A	LOC_Os07g43120.1	intron_variant ; MODIFIER	silent_mutation	Average:22.088; most accessible tissue: Callus, score: 37.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725840534	NA	3.73E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.13E-08	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	5.12E-30	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	8.45E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	2.13E-06	mr1914	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	7.76E-07	mr1927	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.69E-06	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	7.63E-06	8.93E-15	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	2.70E-14	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	6.75E-07	1.74E-07	mr1603_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	2.27E-09	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	3.19E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	8.77E-12	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.01E-10	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	7.48E-09	7.32E-18	mr1818_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	6.50E-08	8.70E-14	mr1818_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	4.60E-29	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.55E-18	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.12E-12	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	6.21E-10	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	1.04E-14	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	5.96E-14	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725840534	NA	8.52E-14	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251