\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725833077:

Variant ID: vg0725833077 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25833077
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTCAGCGACCGAGGGCGCGCGCGCGGGCGGCTGCGGCCGGCTTGGGCCGACTTGGGCTGAGGGGGAGAGAGAGAGAGAGATTTGGGCCGACTTTCGGC[A/C]
CAAAGCCAAAAGAAGACTTTTTAAAACTTTTCCAATTTAAATTATTCATGAAATGCAATTCCATTTATTAAAAATACTTCCTTGGCTCAAATAAGTCCCA

Reverse complement sequence

TGGGACTTATTTGAGCCAAGGAAGTATTTTTAATAAATGGAATTGCATTTCATGAATAATTTAAATTGGAAAAGTTTTAAAAAGTCTTCTTTTGGCTTTG[T/G]
GCCGAAAGTCGGCCCAAATCTCTCTCTCTCTCTCCCCCTCAGCCCAAGTCGGCCCAAGCCGGCCGCAGCCGCCCGCGCGCGCGCCCTCGGTCGCTGACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 13.90% 2.86% 0.00% NA
All Indica  2759 98.30% 1.30% 0.43% 0.00% NA
All Japonica  1512 52.40% 40.10% 7.54% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 98.30% 0.50% 1.18% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 97.50% 2.20% 0.38% 0.00% NA
Temperate Japonica  767 16.80% 73.90% 9.26% 0.00% NA
Tropical Japonica  504 95.00% 1.40% 3.57% 0.00% NA
Japonica Intermediate  241 76.30% 13.30% 10.37% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 2.08% 0.00% NA
Intermediate  90 77.80% 17.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725833077 A -> C LOC_Os07g43100.1 downstream_gene_variant ; 2874.0bp to feature; MODIFIER silent_mutation Average:34.047; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0725833077 A -> C LOC_Os07g43110.1 downstream_gene_variant ; 798.0bp to feature; MODIFIER silent_mutation Average:34.047; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0725833077 A -> C LOC_Os07g43100-LOC_Os07g43110 intergenic_region ; MODIFIER silent_mutation Average:34.047; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725833077 NA 6.19E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725833077 NA 7.44E-08 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 6.80E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.78E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.28E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 8.55E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 6.64E-09 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 7.01E-10 mr1330 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.29E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 2.98E-06 mr1441 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 3.96E-09 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.13E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.01E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 2.03E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 7.82E-06 7.82E-06 mr1703 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 2.59E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 3.58E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 2.37E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 3.14E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.91E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.53E-08 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 6.72E-06 1.20E-07 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 3.48E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.08E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.81E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725833077 NA 1.10E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251