Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725627256:

Variant ID: vg0725627256 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25627256
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCGTTTTTGGTGCCGATGACCTATTTGTAAAAAAATTCAAATATATTATTTTCTACTGCAAATAGATCCTAGGTGTCAATGACATTGCCGATGTCCTC[C/T]
TTTATATTTGTGACTTAGCTTTCACCGAGAGGCGAGGGGGACATTACCAACGTCGTTAGCGCCGTCATATTGGACAATGATGCCAATAACACTAGCGTCA

Reverse complement sequence

TGACGCTAGTGTTATTGGCATCATTGTCCAATATGACGGCGCTAACGACGTTGGTAATGTCCCCCTCGCCTCTCGGTGAAAGCTAAGTCACAAATATAAA[G/A]
GAGGACATCGGCAATGTCATTGACACCTAGGATCTATTTGCAGTAGAAAATAATATATTTGAATTTTTTTACAAATAGGTCATCGGCACCAAAAACGCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	18.90%	0.63%	0.00%	NA
All Indica	2759	98.70%	1.20%	0.18%	0.00%	NA
All Japonica	1512	44.40%	54.20%	1.46%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.70%	1.00%	0.25%	0.00%	NA
Temperate Japonica	767	81.20%	17.20%	1.56%	0.00%	NA
Tropical Japonica	504	2.20%	97.20%	0.60%	0.00%	NA
Japonica Intermediate	241	15.40%	81.70%	2.90%	0.00%	NA
VI/Aromatic	96	84.40%	15.60%	0.00%	0.00%	NA
Intermediate	90	70.00%	26.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725627256	C -> T	LOC_Os07g42780.1	upstream_gene_variant ; 347.0bp to feature; MODIFIER	silent_mutation	Average:72.937; most accessible tissue: Minghui63 panicle, score: 91.919	N	N	N	N
vg0725627256	C -> T	LOC_Os07g42770-LOC_Os07g42780	intergenic_region ; MODIFIER	silent_mutation	Average:72.937; most accessible tissue: Minghui63 panicle, score: 91.919	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0725627256	C	T	0.05	0.01	0.0	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725627256	1.50E-07	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0725627256	NA	2.21E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	1.84E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	1.97E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	2.31E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	1.26E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	3.70E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	2.74E-06	NA	mr1036_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725627256	NA	2.95E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251