\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725554561:

Variant ID: vg0725554561 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25554561
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.50, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TATTACCTTAAGTAATCAGATAGGGCACAATGTAGAGGCATATGTCGATGATCTGGTGGTAAAGACGCACCACCAGGACACGTTGCTACAGGATCTGGCC[A/G]
AAACTTTCGATAGTCTTAGGTCCACGTGCGTAAAGCTGAACCCCGATAAGTGTGTGTTCGGCGTGCCGGCGGGCAAAACTTCTCGGTTTTCTAGTCTCTT

Reverse complement sequence

AAGAGACTAGAAAACCGAGAAGTTTTGCCCGCCGGCACGCCGAACACACACTTATCGGGGTTCAGCTTTACGCACGTGGACCTAAGACTATCGAAAGTTT[T/C]
GGCCAGATCCTGTAGCAACGTGTCCTGGTGGTGCGTCTTTACCACCAGATCATCGACATATGCCTCTACATTGTGCCCTATCTGATTACTTAAGGTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.70% 0.28% 0.00% NA
All Indica  2759 93.80% 5.80% 0.40% 0.00% NA
All Japonica  1512 0.10% 99.90% 0.00% 0.00% NA
Aus  269 95.50% 4.10% 0.37% 0.00% NA
Indica I  595 88.90% 10.30% 0.84% 0.00% NA
Indica II  465 92.70% 6.90% 0.43% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 92.50% 7.10% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725554561 A -> G LOC_Os07g42680.1 missense_variant ; p.Lys371Glu; MODERATE nonsynonymous_codon ; K371E Average:30.878; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 benign -0.278 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725554561 NA 5.85E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 1.06E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 9.23E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 1.42E-18 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 8.40E-15 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 1.12E-29 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 9.34E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 6.46E-28 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.96E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 5.20E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.03E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 3.62E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.66E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 9.76E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 3.96E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.14E-08 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 3.88E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.87E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 1.16E-29 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 4.33E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 4.83E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 3.63E-36 mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 2.66E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725554561 NA 4.42E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251