\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725444676:

Variant ID: vg0725444676 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25444676
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCAACAAATATTCGGCCCGCACGCAGTACGTGGCAACCCCGTTCCGGCCCAAATAACATATTGGGCCGGCACGTATGTGGCAAGGAATAAGTTTAATTA[A/T]
ATCCCTCCGCCGAGTCTAAAAATATTTTAGGTGTGACTTATGTTTTTTATTTTTAAAAAAATTCAAATAAAACGGACAATTAAAGTTGGACAAGAAAACT

Reverse complement sequence

AGTTTTCTTGTCCAACTTTAATTGTCCGTTTTATTTGAATTTTTTTAAAAATAAAAAACATAAGTCACACCTAAAATATTTTTAGACTCGGCGGAGGGAT[T/A]
TAATTAAACTTATTCCTTGCCACATACGTGCCGGCCCAATATGTTATTTGGGCCGGAACGGGGTTGCCACGTACTGCGTGCGGGCCGAATATTTGTTGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 9.00% 0.25% 0.00% NA
All Indica  2759 99.60% 0.30% 0.07% 0.00% NA
All Japonica  1512 73.70% 25.90% 0.40% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 92.40% 7.30% 0.26% 0.00% NA
Tropical Japonica  504 44.80% 54.60% 0.60% 0.00% NA
Japonica Intermediate  241 74.30% 25.30% 0.41% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725444676 A -> T LOC_Os07g42510.1 upstream_gene_variant ; 1981.0bp to feature; MODIFIER silent_mutation Average:99.289; most accessible tissue: Minghui63 young leaf, score: 99.647 N N N N
vg0725444676 A -> T LOC_Os07g42520.1 upstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:99.289; most accessible tissue: Minghui63 young leaf, score: 99.647 N N N N
vg0725444676 A -> T LOC_Os07g42530.1 upstream_gene_variant ; 4729.0bp to feature; MODIFIER silent_mutation Average:99.289; most accessible tissue: Minghui63 young leaf, score: 99.647 N N N N
vg0725444676 A -> T LOC_Os07g42500.1 downstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:99.289; most accessible tissue: Minghui63 young leaf, score: 99.647 N N N N
vg0725444676 A -> T LOC_Os07g42510-LOC_Os07g42520 intergenic_region ; MODIFIER silent_mutation Average:99.289; most accessible tissue: Minghui63 young leaf, score: 99.647 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725444676 A T 0.02 0.02 0.01 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725444676 NA 3.43E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 NA 4.22E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 NA 5.79E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 NA 5.88E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 NA 6.22E-08 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 2.58E-06 2.58E-06 mr1399_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725444676 NA 8.08E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251