\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725435511:

Variant ID: vg0725435511 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 25435511
Reference Allele: GCTCTCGCCTCTCGCAlternative Allele: G,TCTCTCGCCTCTCGC
Primary Allele: GSecondary Allele: GCTCTCGCCTCTCGC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAGCGATCCCCACCGACGGCGTGCAAAGCGGCCACCCAGCTCGACGCTCCCGCACGCAGCGCCGCCGCCGCCGCCCGCCGCCGACGACGAGGCCGGTG[GCTCTCGCCTCTCGC/G,TCTCTCGCCTCTCGC]
CTCTCGCCTCGGCCCAAAAAAAATTCCCAAGCTGGATGGGCCAAATACGTGGGCCCTTAGCGGGCGAGGAGACCCGGCCCGTCAACGCGACACGTGTCCC

Reverse complement sequence

GGGACACGTGTCGCGTTGACGGGCCGGGTCTCCTCGCCCGCTAAGGGCCCACGTATTTGGCCCATCCAGCTTGGGAATTTTTTTTGGGCCGAGGCGAGAG[GCGAGAGGCGAGAGC/C,GCGAGAGGCGAGAGA]
CACCGGCCTCGTCGTCGGCGGCGGGCGGCGGCGGCGGCGCTGCGTGCGGGAGCGTCGAGCTGGGTGGCCGCTTTGCACGCCGTCGGTGGGGATCGCTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GCTCTCGCCTCTCGC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 26.10% 0.51% 0.13% TCTCTCGCCTCTCGC: 18.51%
All Indica  2759 88.20% 7.40% 0.54% 0.18% TCTCTCGCCTCTCGC: 3.62%
All Japonica  1512 0.10% 56.40% 0.20% 0.00% TCTCTCGCCTCTCGC: 43.25%
Aus  269 42.80% 53.90% 0.37% 0.00% TCTCTCGCCTCTCGC: 2.97%
Indica I  595 89.60% 3.50% 0.84% 0.00% TCTCTCGCCTCTCGC: 6.05%
Indica II  465 91.00% 3.70% 0.22% 0.00% TCTCTCGCCTCTCGC: 5.16%
Indica III  913 86.90% 12.40% 0.22% 0.22% TCTCTCGCCTCTCGC: 0.33%
Indica Intermediate  786 87.20% 6.90% 0.89% 0.38% TCTCTCGCCTCTCGC: 4.71%
Temperate Japonica  767 0.10% 87.90% 0.13% 0.00% TCTCTCGCCTCTCGC: 11.86%
Tropical Japonica  504 0.00% 11.70% 0.00% 0.00% TCTCTCGCCTCTCGC: 88.29%
Japonica Intermediate  241 0.40% 49.80% 0.83% 0.00% TCTCTCGCCTCTCGC: 48.96%
VI/Aromatic  96 4.20% 5.20% 1.04% 0.00% TCTCTCGCCTCTCGC: 89.58%
Intermediate  90 34.40% 30.00% 4.44% 1.11% TCTCTCGCCTCTCGC: 30.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725435511 GCTCTCGCCTCTCGC -> DEL N N silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> TCTCTCGCCTCTCGC LOC_Os07g42500.1 upstream_gene_variant ; 220.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> TCTCTCGCCTCTCGC LOC_Os07g42490.1 downstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> TCTCTCGCCTCTCGC LOC_Os07g42490.2 downstream_gene_variant ; 334.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> TCTCTCGCCTCTCGC LOC_Os07g42490-LOC_Os07g42500 intergenic_region ; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> G LOC_Os07g42500.1 upstream_gene_variant ; 219.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> G LOC_Os07g42490.1 downstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> G LOC_Os07g42490.2 downstream_gene_variant ; 335.0bp to feature; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N
vg0725435511 GCTCTCGCCTCTCGC -> G LOC_Os07g42490-LOC_Os07g42500 intergenic_region ; MODIFIER silent_mutation Average:98.998; most accessible tissue: Callus, score: 99.518 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725435511 GCTCT* G 0.11 0.17 0.07 0.05 0.09 0.13
vg0725435511 GCTCT* TCTCT* -0.03 -0.04 -0.05 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725435511 NA 3.21E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 4.04E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 2.55E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 1.77E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 4.67E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 6.81E-13 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 9.59E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 3.33E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 9.84E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 1.11E-07 1.10E-07 mr1954 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 1.21E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 9.14E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 1.78E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 6.78E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 2.08E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 4.00E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 5.56E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 6.51E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725435511 NA 1.51E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251