\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725407361:

Variant ID: vg0725407361 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25407361
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGGTACTTGGCAGTATTGCCGGTCGTATTGCTGAAGCACTACTCCCTCCGTCAAAAAAAAAAAACAAACCCTGATTTCCGTGTCCAATGTTTGACCGT[C/T]
CGTCTTATTTGAAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGCTTAAAATATTAATCATGTTTTATCATCTAACAACAATGAAAATACAAATTAT

Reverse complement sequence

ATAATTTGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATATTTTAAGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTTCAAATAAGACG[G/A]
ACGGTCAAACATTGGACACGGAAATCAGGGTTTGTTTTTTTTTTTTGACGGAGGGAGTAGTGCTTCAGCAATACGACCGGCAATACTGCCAAGTACCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 4.40% 1.33% 2.01% NA
All Indica  2759 97.00% 2.60% 0.25% 0.18% NA
All Japonica  1512 87.40% 3.40% 3.24% 5.89% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 96.60% 0.90% 1.51% 1.08% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.20% 3.80% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.70% 0.13% 0.13% NA
Tropical Japonica  504 74.60% 0.80% 8.93% 15.67% NA
Japonica Intermediate  241 86.70% 8.30% 1.24% 3.73% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 86.70% 5.60% 6.67% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725407361 C -> DEL N N silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42440.1 upstream_gene_variant ; 971.0bp to feature; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42440.4 upstream_gene_variant ; 971.0bp to feature; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42440.3 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42440.2 upstream_gene_variant ; 985.0bp to feature; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42430.1 downstream_gene_variant ; 1409.0bp to feature; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N
vg0725407361 C -> T LOC_Os07g42430-LOC_Os07g42440 intergenic_region ; MODIFIER silent_mutation Average:85.684; most accessible tissue: Minghui63 flower, score: 96.754 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725407361 C T -0.04 -0.07 -0.03 -0.05 -0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725407361 NA 3.14E-08 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 4.92E-06 NA mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 NA 6.81E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 NA 4.71E-07 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 1.30E-06 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 2.89E-07 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 NA 3.63E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725407361 NA 1.18E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251