Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725403826:

Variant ID: vg0725403826 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25403826
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCAAATTTCGAAAGCGAAGTGGCCAAAAATTGACCTTTGGATATGTCTTGCAACTTCCACATATACTACAGTAACAAATATGTTTAAACGATTTACTA[T/C]
CTCCATATTTTAATGCATGACGCCGTTGACTTTTTGTCCAACGTTTGATCATTCGTCTTATTAAAAAAATGTATGTAATTATCATTTATTTTATTGTGAC

Reverse complement sequence

GTCACAATAAAATAAATGATAATTACATACATTTTTTTAATAAGACGAATGATCAAACGTTGGACAAAAAGTCAACGGCGTCATGCATTAAAATATGGAG[A/G]
TAGTAAATCGTTTAAACATATTTGTTACTGTAGTATATGTGGAAGTTGCAAGACATATCCAAAGGTCAATTTTTGGCCACTTCGCTTTCGAAATTTGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	29.00%	0.40%	4.02%	NA
All Indica	2759	97.80%	1.40%	0.25%	0.54%	NA
All Japonica	1512	3.80%	84.90%	0.33%	11.04%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	94.20%	2.60%	0.00%	3.23%	NA
Indica III	913	99.60%	0.00%	0.44%	0.00%	NA
Indica Intermediate	786	97.30%	2.30%	0.38%	0.00%	NA
Temperate Japonica	767	3.50%	96.00%	0.39%	0.13%	NA
Tropical Japonica	504	1.40%	68.50%	0.40%	29.76%	NA
Japonica Intermediate	241	9.50%	83.80%	0.00%	6.64%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	36.70%	5.56%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725403826	T -> DEL	N	N	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42430.1	upstream_gene_variant ; 454.0bp to feature; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42440.1	upstream_gene_variant ; 4506.0bp to feature; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42440.4	upstream_gene_variant ; 4506.0bp to feature; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42440.3	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42440.2	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N
vg0725403826	T -> C	LOC_Os07g42420-LOC_Os07g42430	intergenic_region ; MODIFIER	silent_mutation	Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725403826	NA	1.13E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826	NA	1.18E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826	9.61E-07	6.82E-32	mr1913_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826	NA	7.80E-07	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251