\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725403826:

Variant ID: vg0725403826 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25403826
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCAAATTTCGAAAGCGAAGTGGCCAAAAATTGACCTTTGGATATGTCTTGCAACTTCCACATATACTACAGTAACAAATATGTTTAAACGATTTACTA[T/C]
CTCCATATTTTAATGCATGACGCCGTTGACTTTTTGTCCAACGTTTGATCATTCGTCTTATTAAAAAAATGTATGTAATTATCATTTATTTTATTGTGAC

Reverse complement sequence

GTCACAATAAAATAAATGATAATTACATACATTTTTTTAATAAGACGAATGATCAAACGTTGGACAAAAAGTCAACGGCGTCATGCATTAAAATATGGAG[A/G]
TAGTAAATCGTTTAAACATATTTGTTACTGTAGTATATGTGGAAGTTGCAAGACATATCCAAAGGTCAATTTTTGGCCACTTCGCTTTCGAAATTTGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 29.00% 0.40% 4.02% NA
All Indica  2759 97.80% 1.40% 0.25% 0.54% NA
All Japonica  1512 3.80% 84.90% 0.33% 11.04% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 94.20% 2.60% 0.00% 3.23% NA
Indica III  913 99.60% 0.00% 0.44% 0.00% NA
Indica Intermediate  786 97.30% 2.30% 0.38% 0.00% NA
Temperate Japonica  767 3.50% 96.00% 0.39% 0.13% NA
Tropical Japonica  504 1.40% 68.50% 0.40% 29.76% NA
Japonica Intermediate  241 9.50% 83.80% 0.00% 6.64% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 48.90% 36.70% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725403826 T -> DEL N N silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42430.1 upstream_gene_variant ; 454.0bp to feature; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42440.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42440.4 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42440.3 upstream_gene_variant ; 4520.0bp to feature; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42440.2 upstream_gene_variant ; 4520.0bp to feature; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N
vg0725403826 T -> C LOC_Os07g42420-LOC_Os07g42430 intergenic_region ; MODIFIER silent_mutation Average:26.344; most accessible tissue: Zhenshan97 root, score: 47.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725403826 NA 1.13E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826 NA 1.18E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826 9.61E-07 6.82E-32 mr1913_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725403826 NA 7.80E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251