| Variant ID: vg0725366664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25366664 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 318. )
GTTGAAAAACCAGAGAAAAATTATGAAGAATTTATTTTTTTTATGGGTGTTACCGAGTCTTTACGATACCCCGGCGGTAAAAGTGGTAATTGACGATAAA[T/G]
GAGACACTGCTTCGAGGCATGTGAGTTCGATTAACAAATAGATACCGTATGACGGTATGAGTATTGTCATGTACGTAATTCTAACTATGGAATATGGAAC
GTTCCATATTCCATAGTTAGAATTACGTACATGACAATACTCATACCGTCATACGGTATCTATTTGTTAATCGAACTCACATGCCTCGAAGCAGTGTCTC[A/C]
TTTATCGTCAATTACCACTTTTACCGCCGGGGTATCGTAAAGACTCGGTAACACCCATAAAAAAAATAAATTCTTCATAATTTTTCTCTGGTTTTTCAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 11.10% | 0.99% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 64.10% | 32.90% | 3.04% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 33.00% | 61.80% | 5.22% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 7.90% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725366664 | T -> G | LOC_Os07g42390.1 | upstream_gene_variant ; 2104.0bp to feature; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0725366664 | T -> G | LOC_Os07g42390.2 | upstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0725366664 | T -> G | LOC_Os07g42380.1 | downstream_gene_variant ; 3897.0bp to feature; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0725366664 | T -> G | LOC_Os07g42395.1 | downstream_gene_variant ; 2798.0bp to feature; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0725366664 | T -> G | LOC_Os07g42395.2 | downstream_gene_variant ; 2557.0bp to feature; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| vg0725366664 | T -> G | LOC_Os07g42390-LOC_Os07g42395 | intergenic_region ; MODIFIER | silent_mutation | Average:60.744; most accessible tissue: Minghui63 flower, score: 71.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725366664 | NA | 4.73E-14 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0725366664 | NA | 7.77E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0725366664 | NA | 1.11E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0725366664 | NA | 5.30E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 5.35E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 9.58E-06 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 5.00E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 1.11E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 6.34E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725366664 | NA | 3.48E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/