Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725365363:

Variant ID: vg0725365363 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25365363
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCTTTTGTGTGAATGAGAATCTTTACATGATTTCCTAACTCATGTATATATGGAGAGAAAAAAATTTCTCTTAATAACTAAATACTGGTAAAAATTTT[C/T]
CCACCAGGTAACAACCTTATAAACGGAGATCCATTTAAAACAATCTAGAAATAACATTATACCTTTGAGTTTCCGGTCTTGAGTCCATCTTTCACACTTC

Reverse complement sequence

GAAGTGTGAAAGATGGACTCAAGACCGGAAACTCAAAGGTATAATGTTATTTCTAGATTGTTTTAAATGGATCTCCGTTTATAAGGTTGTTACCTGGTGG[G/A]
AAAATTTTTACCAGTATTTAGTTATTAAGAGAAATTTTTTTCTCTCCATATATACATGAGTTAGGAAATCATGTAAAGATTCTCATTCACACAAAAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.30%	0.06%	0.00%	NA
All Indica	2759	89.90%	10.00%	0.11%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	90.30%	9.60%	0.17%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	85.80%	14.20%	0.00%	0.00%	NA
Indica Intermediate	786	88.80%	10.90%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725365363	C -> T	LOC_Os07g42390.1	upstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0725365363	C -> T	LOC_Os07g42380.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0725365363	C -> T	LOC_Os07g42395.1	downstream_gene_variant ; 4099.0bp to feature; MODIFIER	silent_mutation	Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0725365363	C -> T	LOC_Os07g42395.2	downstream_gene_variant ; 3858.0bp to feature; MODIFIER	silent_mutation	Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0725365363	C -> T	LOC_Os07g42390.2	intron_variant ; MODIFIER	silent_mutation	Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725365363	NA	2.44E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	1.02E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	9.87E-08	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	3.38E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	2.53E-07	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	5.51E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	9.30E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	8.12E-06	4.70E-13	mr1155	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	2.06E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	7.68E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	1.54E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	9.96E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	1.02E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	2.08E-07	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	1.37E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	3.18E-08	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	2.10E-08	1.26E-13	mr1155_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	7.16E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	5.15E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	1.69E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363	NA	2.88E-09	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251