\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725365363:

Variant ID: vg0725365363 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25365363
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTTTGTGTGAATGAGAATCTTTACATGATTTCCTAACTCATGTATATATGGAGAGAAAAAAATTTCTCTTAATAACTAAATACTGGTAAAAATTTT[C/T]
CCACCAGGTAACAACCTTATAAACGGAGATCCATTTAAAACAATCTAGAAATAACATTATACCTTTGAGTTTCCGGTCTTGAGTCCATCTTTCACACTTC

Reverse complement sequence

GAAGTGTGAAAGATGGACTCAAGACCGGAAACTCAAAGGTATAATGTTATTTCTAGATTGTTTTAAATGGATCTCCGTTTATAAGGTTGTTACCTGGTGG[G/A]
AAAATTTTTACCAGTATTTAGTTATTAAGAGAAATTTTTTTCTCTCCATATATACATGAGTTAGGAAATCATGTAAAGATTCTCATTCACACAAAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.60% 6.30% 0.06% 0.00% NA
All Indica  2759 89.90% 10.00% 0.11% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 90.30% 9.60% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 85.80% 14.20% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 10.90% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725365363 C -> T LOC_Os07g42390.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0725365363 C -> T LOC_Os07g42380.1 downstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0725365363 C -> T LOC_Os07g42395.1 downstream_gene_variant ; 4099.0bp to feature; MODIFIER silent_mutation Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0725365363 C -> T LOC_Os07g42395.2 downstream_gene_variant ; 3858.0bp to feature; MODIFIER silent_mutation Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0725365363 C -> T LOC_Os07g42390.2 intron_variant ; MODIFIER silent_mutation Average:52.365; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725365363 NA 2.44E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 1.02E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 9.87E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 3.38E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 2.53E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 5.51E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 9.30E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 8.12E-06 4.70E-13 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 2.06E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 7.68E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 1.54E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 9.96E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 1.02E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 2.08E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 1.37E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 3.18E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 2.10E-08 1.26E-13 mr1155_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 7.16E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 5.15E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 1.69E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725365363 NA 2.88E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251