\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725325993:

Variant ID: vg0725325993 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25325993
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTGACACTACCTAGTACTGTGAATCTGGACAGCCGTACTATCTAGTACTACGAATCTGAACATGAGAGGTAGTGTCACACCCGTACTAGCTACATTTTGG[A/G]
TTGTCCAGATTCGTAGTACTAGTTAGTGTTGCATAACGTACTAGGTAGCTACATTTTGTAACCGAGGAAGTAGCTAATATTGTCACTCCGTTTTTCGCGT

Reverse complement sequence

ACGCGAAAAACGGAGTGACAATATTAGCTACTTCCTCGGTTACAAAATGTAGCTACCTAGTACGTTATGCAACACTAACTAGTACTACGAATCTGGACAA[T/C]
CCAAAATGTAGCTAGTACGGGTGTGACACTACCTCTCATGTTCAGATTCGTAGTACTAGATAGTACGGCTGTCCAGATTCACAGTACTAGGTAGTGTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.60% 0.30% 0.00% NA
All Indica  2759 94.60% 5.20% 0.18% 0.00% NA
All Japonica  1512 3.40% 96.20% 0.40% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 90.90% 8.70% 0.34% 0.00% NA
Indica II  465 92.00% 7.70% 0.22% 0.00% NA
Indica III  913 99.00% 0.90% 0.11% 0.00% NA
Indica Intermediate  786 93.80% 6.10% 0.13% 0.00% NA
Temperate Japonica  767 5.30% 94.10% 0.52% 0.00% NA
Tropical Japonica  504 0.00% 99.80% 0.20% 0.00% NA
Japonica Intermediate  241 4.10% 95.40% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 43.30% 53.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725325993 A -> G LOC_Os07g42324.1 upstream_gene_variant ; 769.0bp to feature; MODIFIER silent_mutation Average:87.972; most accessible tissue: Callus, score: 94.147 N N N N
vg0725325993 A -> G LOC_Os07g42340.1 upstream_gene_variant ; 4114.0bp to feature; MODIFIER silent_mutation Average:87.972; most accessible tissue: Callus, score: 94.147 N N N N
vg0725325993 A -> G LOC_Os07g42310.1 downstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:87.972; most accessible tissue: Callus, score: 94.147 N N N N
vg0725325993 A -> G LOC_Os07g42310-LOC_Os07g42324 intergenic_region ; MODIFIER silent_mutation Average:87.972; most accessible tissue: Callus, score: 94.147 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725325993 A G -0.15 0.0 -0.01 0.0 0.04 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725325993 NA 2.13E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 2.73E-06 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.04E-07 7.38E-10 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 6.20E-06 NA mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 7.07E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 3.29E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 1.56E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 7.27E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 1.66E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.76E-07 1.76E-07 mr1281_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 6.98E-13 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 3.99E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 1.06E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 6.12E-06 mr1677_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 6.33E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 3.67E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.27E-08 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.41E-06 1.01E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 2.69E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.14E-09 NA mr1842_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.50E-07 8.44E-10 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.19E-06 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 4.54E-06 7.21E-09 mr1902_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 5.41E-06 mr1912_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 NA 1.40E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725325993 1.40E-06 NA mr1933_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251