\
| Variant ID: vg0725312091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25312091 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTTGTGTGTGTACATTTATGTACTGTATCTTATGTTCAGATGTACTAATATATCCATATATGTACTCTACTAGTAGACTACTAGTATGCTAAAATACAT[T/C]
GGTACTCCCACTATCCAATAATATAAGAGATTTTGAGTTTTTACTTATAACGTTTGACCACTTGTCTTATTCAAATTTTTTTAAATTATTATTTATTTTA
TAAAATAAATAATAATTTAAAAAAATTTGAATAAGACAAGTGGTCAAACGTTATAAGTAAAAACTCAAAATCTCTTATATTATTGGATAGTGGGAGTACC[A/G]
ATGTATTTTAGCATACTAGTAGTCTACTAGTAGAGTACATATATGGATATATTAGTACATCTGAACATAAGATACAGTACATAAATGTACACACACAAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 94.90% | 5.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.80% | 8.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725312091 | T -> C | LOC_Os07g42290.1 | downstream_gene_variant ; 454.0bp to feature; MODIFIER | silent_mutation | Average:58.36; most accessible tissue: Callus, score: 88.817 | N | N | N | N |
| vg0725312091 | T -> C | LOC_Os07g42300.1 | downstream_gene_variant ; 2237.0bp to feature; MODIFIER | silent_mutation | Average:58.36; most accessible tissue: Callus, score: 88.817 | N | N | N | N |
| vg0725312091 | T -> C | LOC_Os07g42290-LOC_Os07g42300 | intergenic_region ; MODIFIER | silent_mutation | Average:58.36; most accessible tissue: Callus, score: 88.817 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725312091 | NA | 7.87E-07 | mr1138 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | 3.44E-06 | 1.07E-09 | mr1354 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | 5.08E-09 | 2.00E-10 | mr1829 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | 1.10E-06 | 1.10E-06 | mr1281_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | NA | 1.23E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | 8.13E-06 | 3.99E-10 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | 8.55E-06 | 4.66E-08 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725312091 | NA | 9.25E-09 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |