\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725312091:

Variant ID: vg0725312091 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25312091
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTGTGTGTGTACATTTATGTACTGTATCTTATGTTCAGATGTACTAATATATCCATATATGTACTCTACTAGTAGACTACTAGTATGCTAAAATACAT[T/C]
GGTACTCCCACTATCCAATAATATAAGAGATTTTGAGTTTTTACTTATAACGTTTGACCACTTGTCTTATTCAAATTTTTTTAAATTATTATTTATTTTA

Reverse complement sequence

TAAAATAAATAATAATTTAAAAAAATTTGAATAAGACAAGTGGTCAAACGTTATAAGTAAAAACTCAAAATCTCTTATATTATTGGATAGTGGGAGTACC[A/G]
ATGTATTTTAGCATACTAGTAGTCTACTAGTAGAGTACATATATGGATATATTAGTACATCTGAACATAAGATACAGTACATAAATGTACACACACAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.90% 0.02% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.90% 5.00% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.80% 8.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725312091 T -> C LOC_Os07g42290.1 downstream_gene_variant ; 454.0bp to feature; MODIFIER silent_mutation Average:58.36; most accessible tissue: Callus, score: 88.817 N N N N
vg0725312091 T -> C LOC_Os07g42300.1 downstream_gene_variant ; 2237.0bp to feature; MODIFIER silent_mutation Average:58.36; most accessible tissue: Callus, score: 88.817 N N N N
vg0725312091 T -> C LOC_Os07g42290-LOC_Os07g42300 intergenic_region ; MODIFIER silent_mutation Average:58.36; most accessible tissue: Callus, score: 88.817 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725312091 NA 7.87E-07 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 3.44E-06 1.07E-09 mr1354 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 5.08E-09 2.00E-10 mr1829 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 1.10E-06 1.10E-06 mr1281_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 NA 1.23E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 8.13E-06 3.99E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 8.55E-06 4.66E-08 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725312091 NA 9.25E-09 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251