Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725129140:

Variant ID: vg0725129140 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25129140
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.14, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CGATTGCAACCTTGGGTCTCCTTTAGCATGCAGACCGCTTGACGAACCAGTAATCCCCTTCGGTCGCCTTCATAGAAATTGCACAAATTGGAGATTTGCT[G/A]
TTGAGCCGTAGATTTTGGTGTAGGTTTCACCGGACTCAACCAAACTTCACCATGGATCGAGTTCGCCATTGAATCTGAGGAGCTTGAGCTCAACCCAAAT

Reverse complement sequence

ATTTGGGTTGAGCTCAAGCTCCTCAGATTCAATGGCGAACTCGATCCATGGTGAAGTTTGGTTGAGTCCGGTGAAACCTACACCAAAATCTACGGCTCAA[C/T]
AGCAAATCTCCAATTTGTGCAATTTCTATGAAGGCGACCGAAGGGGATTACTGGTTCGTCAAGCGGTCTGCATGCTAAAGGAGACCCAAGGTTGCAATCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.10%	36.10%	0.36%	17.50%	NA
All Indica	2759	77.90%	10.40%	0.33%	11.38%	NA
All Japonica	1512	0.50%	68.10%	0.46%	30.89%	NA
Aus	269	0.00%	93.70%	0.00%	6.32%	NA
Indica I	595	80.50%	18.80%	0.17%	0.50%	NA
Indica II	465	77.00%	9.00%	0.86%	13.12%	NA
Indica III	913	80.50%	5.10%	0.11%	14.24%	NA
Indica Intermediate	786	73.50%	10.80%	0.38%	15.27%	NA
Temperate Japonica	767	0.80%	42.20%	0.78%	56.19%	NA
Tropical Japonica	504	0.00%	99.40%	0.00%	0.60%	NA
Japonica Intermediate	241	0.80%	85.10%	0.41%	13.69%	NA
VI/Aromatic	96	2.10%	84.40%	0.00%	13.54%	NA
Intermediate	90	18.90%	62.20%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725129140	G -> DEL	LOC_Os07g41970.1	N	frameshift_variant	Average:62.788; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0725129140	G -> A	LOC_Os07g41970.1	stop_gained ; p.Gln112*; HIGH	stop_gained	Average:62.788; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725129140	NA	5.83E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	3.40E-11	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	7.50E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.38E-30	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	9.12E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	8.30E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	6.89E-08	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	3.71E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	3.04E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	2.34E-10	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	5.18E-20	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	3.28E-15	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	5.63E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.53E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.11E-08	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	8.88E-27	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	2.14E-14	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.70E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	6.74E-08	mr1722_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	2.78E-14	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.35E-06	mr1734_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.04E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	4.23E-06	mr1815_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	3.41E-09	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	6.96E-06	mr1834_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725129140	NA	1.22E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251