\
| Variant ID: vg0725097326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25097326 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 111. )
TTTTTCCATTAGCTACCATGGGATTTTTTTTCCATTAGCTACCATGGGATAGATGCTAATCACGTTGGAGTGACTAGATGGGAACTAATATTTTATTGCT[T/A]
AATTATACTATAATATATGAGATTAATATTAATTGGAAAATTCCTGTGGTTTATATATTCCTGTGTTCCGAACGCTTCGTACTATCAAATTCTTTTGTTT
AAACAAAAGAATTTGATAGTACGAAGCGTTCGGAACACAGGAATATATAAACCACAGGAATTTTCCAATTAATATTAATCTCATATATTATAGTATAATT[A/T]
AGCAATAAAATATTAGTTCCCATCTAGTCACTCCAACGTGATTAGCATCTATCCCATGGTAGCTAATGGAAAAAAAATCCCATGGTAGCTAATGGAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 14.60% | 21.56% | 14.58% | NA |
| All Indica | 2759 | 41.00% | 24.30% | 34.11% | 0.62% | NA |
| All Japonica | 1512 | 55.40% | 0.20% | 1.79% | 42.66% | NA |
| Aus | 269 | 86.20% | 4.50% | 9.29% | 0.00% | NA |
| Indica I | 595 | 73.80% | 3.50% | 22.69% | 0.00% | NA |
| Indica II | 465 | 48.80% | 8.60% | 40.86% | 1.72% | NA |
| Indica III | 913 | 11.50% | 53.30% | 35.05% | 0.11% | NA |
| Indica Intermediate | 786 | 45.80% | 15.50% | 37.66% | 1.02% | NA |
| Temperate Japonica | 767 | 42.60% | 0.10% | 0.65% | 56.58% | NA |
| Tropical Japonica | 504 | 62.90% | 0.40% | 2.78% | 33.93% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 3.32% | 16.60% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 6.25% | 10.42% | NA |
| Intermediate | 90 | 54.40% | 4.40% | 22.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725097326 | T -> DEL | N | N | silent_mutation | Average:35.643; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0725097326 | T -> A | LOC_Os07g41880.1 | upstream_gene_variant ; 2511.0bp to feature; MODIFIER | silent_mutation | Average:35.643; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0725097326 | T -> A | LOC_Os07g41890.1 | upstream_gene_variant ; 380.0bp to feature; MODIFIER | silent_mutation | Average:35.643; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0725097326 | T -> A | LOC_Os07g41900.1 | upstream_gene_variant ; 3074.0bp to feature; MODIFIER | silent_mutation | Average:35.643; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0725097326 | T -> A | LOC_Os07g41880-LOC_Os07g41890 | intergenic_region ; MODIFIER | silent_mutation | Average:35.643; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725097326 | NA | 2.16E-09 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | NA | 2.58E-10 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | 4.60E-06 | 4.58E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | 2.10E-06 | 2.10E-06 | mr1478_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | NA | 7.16E-08 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | NA | 2.03E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725097326 | NA | 2.96E-07 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |