Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725037095:

Variant ID: vg0725037095 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25037095
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATCTTCTCTAGACAGAATTGAACTACGGGCCTGTTTAGCACAGCTCCAGCTCCAGCTCCACTCTTCCTGGAGCTAGAGCTCAGCCAAACAGTTTTAGC[T/A]
CCACCAAAGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCCAGACTCAACTCTTGGAGTTATATTTAG

Reverse complement sequence

CTAAATATAACTCCAAGAGTTGAGTCTGGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCTTTGGTGG[A/T]
GCTAAAACTGTTTGGCTGAGCTCTAGCTCCAGGAAGAGTGGAGCTGGAGCTGGAGCTGTGCTAAACAGGCCCGTAGTTCAATTCTGTCTAGAGAAGATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	4.90%	17.18%	6.58%	NA
All Indica	2759	61.70%	1.20%	26.97%	10.11%	NA
All Japonica	1512	86.80%	12.40%	0.79%	0.00%	NA
Aus	269	72.90%	0.00%	15.24%	11.90%	NA
Indica I	595	52.80%	0.00%	38.32%	8.91%	NA
Indica II	465	52.90%	5.20%	30.97%	10.97%	NA
Indica III	913	69.70%	0.00%	19.06%	11.28%	NA
Indica Intermediate	786	64.50%	1.10%	25.19%	9.16%	NA
Temperate Japonica	767	98.40%	0.50%	1.04%	0.00%	NA
Tropical Japonica	504	66.70%	32.90%	0.40%	0.00%	NA
Japonica Intermediate	241	92.10%	7.10%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	0.00%	6.25%	0.00%	NA
Intermediate	90	75.60%	14.40%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725037095	T -> DEL	N	N	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0725037095	T -> A	LOC_Os07g41780.1	upstream_gene_variant ; 2030.0bp to feature; MODIFIER	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0725037095	T -> A	LOC_Os07g41800.1	upstream_gene_variant ; 2119.0bp to feature; MODIFIER	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0725037095	T -> A	LOC_Os07g41800.2	upstream_gene_variant ; 2119.0bp to feature; MODIFIER	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0725037095	T -> A	LOC_Os07g41800.3	upstream_gene_variant ; 2119.0bp to feature; MODIFIER	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0725037095	T -> A	LOC_Os07g41790.2	intron_variant ; MODIFIER	silent_mutation	Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725037095	NA	1.10E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	8.02E-07	1.37E-12	mr1136	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	8.34E-06	1.49E-08	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	NA	6.71E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	NA	6.42E-07	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	NA	3.11E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	NA	8.28E-10	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095	9.11E-06	3.83E-10	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251