\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725037095:

Variant ID: vg0725037095 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25037095
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCTTCTCTAGACAGAATTGAACTACGGGCCTGTTTAGCACAGCTCCAGCTCCAGCTCCACTCTTCCTGGAGCTAGAGCTCAGCCAAACAGTTTTAGC[T/A]
CCACCAAAGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCCAGACTCAACTCTTGGAGTTATATTTAG

Reverse complement sequence

CTAAATATAACTCCAAGAGTTGAGTCTGGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCTTTGGTGG[A/T]
GCTAAAACTGTTTGGCTGAGCTCTAGCTCCAGGAAGAGTGGAGCTGGAGCTGGAGCTGTGCTAAACAGGCCCGTAGTTCAATTCTGTCTAGAGAAGATCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 4.90% 17.18% 6.58% NA
All Indica  2759 61.70% 1.20% 26.97% 10.11% NA
All Japonica  1512 86.80% 12.40% 0.79% 0.00% NA
Aus  269 72.90% 0.00% 15.24% 11.90% NA
Indica I  595 52.80% 0.00% 38.32% 8.91% NA
Indica II  465 52.90% 5.20% 30.97% 10.97% NA
Indica III  913 69.70% 0.00% 19.06% 11.28% NA
Indica Intermediate  786 64.50% 1.10% 25.19% 9.16% NA
Temperate Japonica  767 98.40% 0.50% 1.04% 0.00% NA
Tropical Japonica  504 66.70% 32.90% 0.40% 0.00% NA
Japonica Intermediate  241 92.10% 7.10% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 75.60% 14.40% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725037095 T -> DEL N N silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0725037095 T -> A LOC_Os07g41780.1 upstream_gene_variant ; 2030.0bp to feature; MODIFIER silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0725037095 T -> A LOC_Os07g41800.1 upstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0725037095 T -> A LOC_Os07g41800.2 upstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0725037095 T -> A LOC_Os07g41800.3 upstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0725037095 T -> A LOC_Os07g41790.2 intron_variant ; MODIFIER silent_mutation Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0725037095 NA 1.10E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 8.02E-07 1.37E-12 mr1136 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 8.34E-06 1.49E-08 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 NA 6.71E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 NA 6.42E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 NA 3.11E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 NA 8.28E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725037095 9.11E-06 3.83E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251