\
| Variant ID: vg0725037095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25037095 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGATCTTCTCTAGACAGAATTGAACTACGGGCCTGTTTAGCACAGCTCCAGCTCCAGCTCCACTCTTCCTGGAGCTAGAGCTCAGCCAAACAGTTTTAGC[T/A]
CCACCAAAGAGCTCTCTCACAAAATGTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCCAGACTCAACTCTTGGAGTTATATTTAG
CTAAATATAACTCCAAGAGTTGAGTCTGGAGTGGAGTTGTGGAGCTGCCTAAACCCAGCTCCACAACTCTAGTACATTTTGTGAGAGAGCTCTTTGGTGG[A/T]
GCTAAAACTGTTTGGCTGAGCTCTAGCTCCAGGAAGAGTGGAGCTGGAGCTGGAGCTGTGCTAAACAGGCCCGTAGTTCAATTCTGTCTAGAGAAGATCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 4.90% | 17.18% | 6.58% | NA |
| All Indica | 2759 | 61.70% | 1.20% | 26.97% | 10.11% | NA |
| All Japonica | 1512 | 86.80% | 12.40% | 0.79% | 0.00% | NA |
| Aus | 269 | 72.90% | 0.00% | 15.24% | 11.90% | NA |
| Indica I | 595 | 52.80% | 0.00% | 38.32% | 8.91% | NA |
| Indica II | 465 | 52.90% | 5.20% | 30.97% | 10.97% | NA |
| Indica III | 913 | 69.70% | 0.00% | 19.06% | 11.28% | NA |
| Indica Intermediate | 786 | 64.50% | 1.10% | 25.19% | 9.16% | NA |
| Temperate Japonica | 767 | 98.40% | 0.50% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 66.70% | 32.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 6.25% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 14.40% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725037095 | T -> DEL | N | N | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0725037095 | T -> A | LOC_Os07g41780.1 | upstream_gene_variant ; 2030.0bp to feature; MODIFIER | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0725037095 | T -> A | LOC_Os07g41800.1 | upstream_gene_variant ; 2119.0bp to feature; MODIFIER | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0725037095 | T -> A | LOC_Os07g41800.2 | upstream_gene_variant ; 2119.0bp to feature; MODIFIER | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0725037095 | T -> A | LOC_Os07g41800.3 | upstream_gene_variant ; 2119.0bp to feature; MODIFIER | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg0725037095 | T -> A | LOC_Os07g41790.2 | intron_variant ; MODIFIER | silent_mutation | Average:69.548; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725037095 | NA | 1.10E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | 8.02E-07 | 1.37E-12 | mr1136 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | 8.34E-06 | 1.49E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | NA | 6.71E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | NA | 6.42E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | NA | 3.11E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | NA | 8.28E-10 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725037095 | 9.11E-06 | 3.83E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |