\
| Variant ID: vg0725004532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 25004532 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )
CCAAATACTAGTAACAAAAAGTAGGTAAGTTGGTATTTGTCATTTGGGAGTCCATAGCAGCAAATTTGGCTAAAAAGCACCGGCCCCGTGCATGAGAGAG[G/A]
CAGCAGCAATTAATAGCAAAACTTTACCATACATCTAAACACTAACTTATAAAATTGCAATGCCAAATCTTTTGCCACCAAAACTTTTGCTAAAAAAATT
AATTTTTTTAGCAAAAGTTTTGGTGGCAAAAGATTTGGCATTGCAATTTTATAAGTTAGTGTTTAGATGTATGGTAAAGTTTTGCTATTAATTGCTGCTG[C/T]
CTCTCTCATGCACGGGGCCGGTGCTTTTTAGCCAAATTTGCTGCTATGGACTCCCAAATGACAAATACCAACTTACCTACTTTTTGTTACTAGTATTTGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 4.80% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 85.80% | 12.10% | 2.12% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 1.20% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 66.90% | 31.20% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0725004532 | G -> A | LOC_Os07g41720.1 | upstream_gene_variant ; 3314.0bp to feature; MODIFIER | silent_mutation | Average:74.593; most accessible tissue: Callus, score: 96.982 | N | N | N | N |
| vg0725004532 | G -> A | LOC_Os07g41730.2 | upstream_gene_variant ; 2691.0bp to feature; MODIFIER | silent_mutation | Average:74.593; most accessible tissue: Callus, score: 96.982 | N | N | N | N |
| vg0725004532 | G -> A | LOC_Os07g41720.2 | upstream_gene_variant ; 3312.0bp to feature; MODIFIER | silent_mutation | Average:74.593; most accessible tissue: Callus, score: 96.982 | N | N | N | N |
| vg0725004532 | G -> A | LOC_Os07g41730.1 | upstream_gene_variant ; 2691.0bp to feature; MODIFIER | silent_mutation | Average:74.593; most accessible tissue: Callus, score: 96.982 | N | N | N | N |
| vg0725004532 | G -> A | LOC_Os07g41720-LOC_Os07g41730 | intergenic_region ; MODIFIER | silent_mutation | Average:74.593; most accessible tissue: Callus, score: 96.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0725004532 | NA | 4.85E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 2.41E-11 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 1.87E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | 8.63E-06 | NA | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 9.52E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | 5.10E-06 | 7.94E-11 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 6.74E-11 | mr1136_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 2.73E-07 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 1.58E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | 3.78E-06 | NA | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | 2.48E-06 | 8.70E-08 | mr1246_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 8.54E-07 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | 9.69E-07 | 9.20E-08 | mr1620_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0725004532 | NA | 1.83E-06 | mr1718_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |