Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0725004532:

Variant ID: vg0725004532 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25004532
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAATACTAGTAACAAAAAGTAGGTAAGTTGGTATTTGTCATTTGGGAGTCCATAGCAGCAAATTTGGCTAAAAAGCACCGGCCCCGTGCATGAGAGAG[G/A]
CAGCAGCAATTAATAGCAAAACTTTACCATACATCTAAACACTAACTTATAAAATTGCAATGCCAAATCTTTTGCCACCAAAACTTTTGCTAAAAAAATT

Reverse complement sequence

AATTTTTTTAGCAAAAGTTTTGGTGGCAAAAGATTTGGCATTGCAATTTTATAAGTTAGTGTTTAGATGTATGGTAAAGTTTTGCTATTAATTGCTGCTG[C/T]
CTCTCTCATGCACGGGGCCGGTGCTTTTTAGCCAAATTTGCTGCTATGGACTCCCAAATGACAAATACCAACTTACCTACTTTTTGTTACTAGTATTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	4.80%	0.76%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.11%	0.00%	NA
All Japonica	1512	85.80%	12.10%	2.12%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.60%	5.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.40%	0.25%	0.00%	NA
Temperate Japonica	767	96.20%	1.20%	2.61%	0.00%	NA
Tropical Japonica	504	66.90%	31.20%	1.98%	0.00%	NA
Japonica Intermediate	241	92.10%	7.10%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725004532	G -> A	LOC_Os07g41720.1	upstream_gene_variant ; 3314.0bp to feature; MODIFIER	silent_mutation	Average:74.593; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0725004532	G -> A	LOC_Os07g41730.2	upstream_gene_variant ; 2691.0bp to feature; MODIFIER	silent_mutation	Average:74.593; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0725004532	G -> A	LOC_Os07g41720.2	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:74.593; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0725004532	G -> A	LOC_Os07g41730.1	upstream_gene_variant ; 2691.0bp to feature; MODIFIER	silent_mutation	Average:74.593; most accessible tissue: Callus, score: 96.982	N	N	N	N
vg0725004532	G -> A	LOC_Os07g41720-LOC_Os07g41730	intergenic_region ; MODIFIER	silent_mutation	Average:74.593; most accessible tissue: Callus, score: 96.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725004532	NA	4.85E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	2.41E-11	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	1.87E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	8.63E-06	NA	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	9.52E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	5.10E-06	7.94E-11	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	6.74E-11	mr1136_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	2.73E-07	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	1.58E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	3.78E-06	NA	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	2.48E-06	8.70E-08	mr1246_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	8.54E-07	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	9.69E-07	9.20E-08	mr1620_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725004532	NA	1.83E-06	mr1718_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251