Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724955950:

Variant ID: vg0724955950 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24955950
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.17, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGTAAAGCGTAGTAAATACTACCACAGAGGCTCTTGGAGGTTGTCTGTACTCCTTCATTCTTATCTTTCACCATAGATTATATTCGTCAAATCGATC[A/T]
ATCGGTAGAAAACACTATATTTTTTATTAGGATTCAACGAGGTCAATAGTATTGATTGATAATATATACTCGAGATAATTTTATCAATTTACTGCTGATT

Reverse complement sequence

AATCAGCAGTAAATTGATAAAATTATCTCGAGTATATATTATCAATCAATACTATTGACCTCGTTGAATCCTAATAAAAAATATAGTGTTTTCTACCGAT[T/A]
GATCGATTTGACGAATATAATCTATGGTGAAAGATAAGAATGAAGGAGTACAGACAACCTCCAAGAGCCTCTGTGGTAGTATTTACTACGCTTTACATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.30% 0.08% 0.00% NA
All Indica  2759 94.60% 5.40% 0.00% 0.00% NA
All Japonica  1512 3.80% 96.00% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.40% 0.00% 0.00% NA
Temperate Japonica  767 5.10% 94.80% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.20% 0.40% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724955950 A -> T LOC_Os07g41620.1 upstream_gene_variant ; 2152.0bp to feature; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N
vg0724955950 A -> T LOC_Os07g41630.1 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N
vg0724955950 A -> T LOC_Os07g41640.1 upstream_gene_variant ; 251.0bp to feature; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N
vg0724955950 A -> T LOC_Os07g41640.3 upstream_gene_variant ; 251.0bp to feature; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N
vg0724955950 A -> T LOC_Os07g41640.2 upstream_gene_variant ; 359.0bp to feature; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N
vg0724955950 A -> T LOC_Os07g41630-LOC_Os07g41640 intergenic_region ; MODIFIER silent_mutation Average:81.905; most accessible tissue: Callus, score: 97.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724955950 NA 6.38E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724955950 NA 5.21E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 2.34E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 1.80E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 7.32E-29 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 3.76E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 8.81E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 6.25E-07 6.25E-07 mr1169_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 9.79E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 1.97E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 9.52E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 5.00E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 1.49E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 4.53E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724955950 NA 5.67E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251