\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724952558:

Variant ID: vg0724952558 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24952558
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGAACCATTACAAAAGCAGATGTTTCACATTGTGACTGAATCTTGACTTTTAATAAAGGCAAATTGACTCAATCAGTTAACATTTTTGTTAGTAAGAA[G/A]
TTTGTAAAGAAATTTTTAGTACATGTAGCATTGCTCTTGCAAATACATATCAATGGAAATGTTATTATTGTGGATTTTTTAATTAGAAGTTTTTTCCCAA

Reverse complement sequence

TTGGGAAAAAACTTCTAATTAAAAAATCCACAATAATAACATTTCCATTGATATGTATTTGCAAGAGCAATGCTACATGTACTAAAAATTTCTTTACAAA[C/T]
TTCTTACTAACAAAAATGTTAACTGATTGAGTCAATTTGCCTTTATTAAAAGTCAAGATTCAGTCACAATGTGAAACATCTGCTTTTGTAATGGTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 0.80% 0.61% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 95.80% 2.40% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 91.70% 4.70% 3.65% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724952558 G -> A LOC_Os07g41640.1 upstream_gene_variant ; 3643.0bp to feature; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N
vg0724952558 G -> A LOC_Os07g41640.3 upstream_gene_variant ; 3643.0bp to feature; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N
vg0724952558 G -> A LOC_Os07g41640.2 upstream_gene_variant ; 3751.0bp to feature; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N
vg0724952558 G -> A LOC_Os07g41610.1 downstream_gene_variant ; 3622.0bp to feature; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N
vg0724952558 G -> A LOC_Os07g41630.1 downstream_gene_variant ; 1560.0bp to feature; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N
vg0724952558 G -> A LOC_Os07g41620.1 intron_variant ; MODIFIER silent_mutation Average:37.532; most accessible tissue: Callus, score: 67.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724952558 NA 1.28E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 1.68E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 3.31E-07 3.31E-07 mr1284 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 1.52E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 4.47E-08 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 5.29E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 1.60E-06 5.54E-07 mr1397 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 7.94E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 1.16E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 6.76E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 6.07E-06 6.07E-06 mr1587 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 8.26E-06 8.26E-06 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 8.22E-06 8.22E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 2.36E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724952558 NA 5.77E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251