Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724951834:

Variant ID: vg0724951834 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24951834
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTTCTTTTTTAAAAGACCATTATGGAGCTTATCCACGGTATCTTGAACCAAGATATGTGTTATTGCCCCTAAGCCTCCAAGAGCATCAAGAAAGGAT[A/G]
GAATATTTTCCATTGTGACCCTATTATGATATAACTCGTTGGCAACCTCACAAAAGATAGTTGTGTACGTCCTCACCATCTGCAATTCAGAAACGATCAG

Reverse complement sequence

CTGATCGTTTCTGAATTGCAGATGGTGAGGACGTACACAACTATCTTTTGTGAGGTTGCCAACGAGTTATATCATAATAGGGTCACAATGGAAAATATTC[T/C]
ATCCTTTCTTGATGCTCTTGGAGGCTTAGGGGCAATAACACATATCTTGGTTCAAGATACCGTGGATAAGCTCCATAATGGTCTTTTAAAAAAGAAAATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 3.70% 0.83% 0.00% NA
All Indica  2759 92.30% 6.30% 1.41% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 0.80% 1.85% 0.00% NA
Indica II  465 88.20% 9.00% 2.80% 0.00% NA
Indica III  913 88.10% 11.60% 0.33% 0.00% NA
Indica Intermediate  786 95.80% 2.70% 1.53% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724951834 A -> G LOC_Os07g41620.1 missense_variant ; p.Leu200Pro; MODERATE nonsynonymous_codon ; L200P Average:45.532; most accessible tissue: Minghui63 flag leaf, score: 56.489 probably damaging 2.097 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724951834 NA 6.04E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 7.62E-07 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 8.48E-07 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 5.17E-08 mr1227 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 7.61E-06 7.61E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.74E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 8.58E-07 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 2.58E-07 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 5.33E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.13E-07 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.72E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 7.03E-06 mr1657 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 8.01E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 5.75E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.21E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 3.40E-06 3.39E-06 mr1724 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.94E-06 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.10E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 9.93E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.21E-07 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.46E-07 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 4.67E-08 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 1.97E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724951834 NA 6.49E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251