\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724945438:

Variant ID: vg0724945438 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24945438
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGGAATTAATGAATGGACCTTAGCCCACTCGAAGATTAATTCTTTGGAAAATCACAAAAGCCCACCTCATGGGATGGCATGCATGTGGAGTTTAGTA[C/T]
CACCTTACTTATTCTAGGAGAGGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTGGTGGAGAGAAGAGGGGGAACACACGC

Reverse complement sequence

GCGTGTGTTCCCCCTCTTCTCTCCACCACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCCTCTCCTAGAATAAGTAAGGTG[G/A]
TACTAAACTCCACATGCATGCCATCCCATGAGGTGGGCTTTTGTGATTTTCCAAAGAATTAATCTTCGAGTGGGCTAAGGTCCATTCATTAATTCCAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 22.20% 2.67% 0.30% NA
All Indica  2759 95.50% 3.90% 0.62% 0.04% NA
All Japonica  1512 35.80% 56.80% 6.61% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 1.80% 0.84% 0.00% NA
Indica II  465 92.70% 6.90% 0.43% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 91.00% 7.60% 1.27% 0.13% NA
Temperate Japonica  767 56.30% 35.50% 8.21% 0.00% NA
Tropical Japonica  504 15.30% 80.20% 3.17% 1.39% NA
Japonica Intermediate  241 13.70% 75.90% 8.71% 1.66% NA
VI/Aromatic  96 39.60% 54.20% 4.17% 2.08% NA
Intermediate  90 62.20% 32.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724945438 C -> DEL N N silent_mutation Average:74.82; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0724945438 C -> T LOC_Os07g41610.1 upstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:74.82; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N
vg0724945438 C -> T LOC_Os07g41600-LOC_Os07g41610 intergenic_region ; MODIFIER silent_mutation Average:74.82; most accessible tissue: Minghui63 panicle, score: 89.949 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724945438 NA 6.97E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 6.12E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 6.10E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 4.09E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 8.96E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 5.43E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.58E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 2.68E-06 1.20E-10 mr1418_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.16E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 9.81E-08 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 2.71E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 4.80E-08 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.17E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 3.82E-09 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.02E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 5.37E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 1.53E-06 3.24E-13 mr1506_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 2.03E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 6.51E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 9.56E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 9.84E-14 mr1646_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 3.55E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.14E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 2.77E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 4.10E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 9.66E-06 6.10E-09 mr1779_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 2.51E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 1.14E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 4.43E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 NA 6.13E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 2.33E-07 1.15E-10 mr1992_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724945438 2.75E-07 2.75E-07 mr1992_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251