\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724939532:

Variant ID: vg0724939532 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24939532
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGCCGCTCGCGCACAGTGGTCGCACTAGTCGTGCACGTTACCCCGTCGCCGTGCGCTCGCGCCGTTGCACGTTCGCGATCGTCAATGGAGATGCTCAT[C/T]
GCTGGGTTTCATTTATTATTTTTATTTTTACGCTACCTGGGGTGTGTGGTGTGCAAACCTGGTGTGGTGGCTGCCGTTGTGCTCTCGTTGTCATGATAAA

Reverse complement sequence

TTTATCATGACAACGAGAGCACAACGGCAGCCACCACACCAGGTTTGCACACCACACACCCCAGGTAGCGTAAAAATAAAAATAATAAATGAAACCCAGC[G/A]
ATGAGCATCTCCATTGACGATCGCGAACGTGCAACGGCGCGAGCGCACGGCGACGGGGTAACGTGCACGACTAGTGCGACCACTGTGCGCGAGCGGCGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 13.40% 3.03% 0.00% NA
All Indica  2759 98.00% 1.70% 0.33% 0.00% NA
All Japonica  1512 54.20% 37.20% 8.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.90% 6.90% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 1.70% 1.02% 0.00% NA
Temperate Japonica  767 83.40% 6.10% 10.43% 0.00% NA
Tropical Japonica  504 22.40% 72.80% 4.76% 0.00% NA
Japonica Intermediate  241 27.80% 61.80% 10.37% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 26.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724939532 C -> T LOC_Os07g41600.1 upstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:97.295; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg0724939532 C -> T LOC_Os07g41600.2 upstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:97.295; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg0724939532 C -> T LOC_Os07g41600.3 upstream_gene_variant ; 2463.0bp to feature; MODIFIER silent_mutation Average:97.295; most accessible tissue: Minghui63 root, score: 99.756 N N N N
vg0724939532 C -> T LOC_Os07g41600-LOC_Os07g41610 intergenic_region ; MODIFIER silent_mutation Average:97.295; most accessible tissue: Minghui63 root, score: 99.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724939532 C T -0.09 -0.07 -0.14 0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724939532 NA 9.04E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 2.86E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 1.95E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 3.81E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 3.36E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 2.91E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 3.88E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 7.27E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 6.26E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 1.26E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 1.57E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 4.15E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 7.76E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 1.17E-06 mr1779_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724939532 NA 1.96E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251