Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724796245:

Variant ID: vg0724796245 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24796245
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

TTATAGCCCATACCACACATTGCACGTCTAAAACGATCAAACCATGCTCTCGGTGACTGTTTGAGACCATACAAAGATTTCTTCAATCTCAACACTTTTC[C/A]
TTTAGTTTGTGAGGTAGCAAATCCAGGTGGGATATCCATATACCTCTTCCTGAAGGTCTCCATGTAAAAAGGCATTCTTGACATCTAGCTGATGCAATGG

Reverse complement sequence

CCATTGCATCAGCTAGATGTCAAGAATGCCTTTTTACATGGAGACCTTCAGGAAGAGGTATATGGATATCCCACCTGGATTTGCTACCTCACAAACTAAA[G/T]
GAAAAGTGTTGAGATTGAAGAAATCTTTGTATGGTCTCAAACAGTCACCGAGAGCATGGTTTGATCGTTTTAGACGTGCAATGTGTGGTATGGGCTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	9.40%	0.08%	1.14%	NA
All Indica	2759	84.10%	14.00%	0.11%	1.88%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	79.90%	19.00%	0.37%	0.74%	NA
Indica I	595	76.50%	20.50%	0.34%	2.69%	NA
Indica II	465	98.90%	0.90%	0.00%	0.22%	NA
Indica III	913	79.50%	18.90%	0.00%	1.53%	NA
Indica Intermediate	786	86.30%	10.90%	0.13%	2.67%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724796245	C -> DEL	N	N	silent_mutation	Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0724796245	C -> A	LOC_Os07g41390.1	upstream_gene_variant ; 4287.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0724796245	C -> A	LOC_Os07g41370.1	downstream_gene_variant ; 2361.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0724796245	C -> A	LOC_Os07g41370.2	downstream_gene_variant ; 2361.0bp to feature; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N
vg0724796245	C -> A	LOC_Os07g41380.1	intron_variant ; MODIFIER	silent_mutation	Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724796245	NA	1.10E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	1.13E-07	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	7.80E-06	mr1163	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	7.88E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	4.41E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	1.15E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	1.18E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	2.82E-10	mr1627	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	3.88E-06	mr1653	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	9.25E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	4.54E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	6.79E-07	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	6.04E-09	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	6.28E-09	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	8.03E-06	mr1755	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	3.59E-06	mr1817	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	9.57E-06	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	3.68E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	4.07E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	4.88E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	9.10E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	4.18E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245	NA	1.08E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251