\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724796245:

Variant ID: vg0724796245 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24796245
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTATAGCCCATACCACACATTGCACGTCTAAAACGATCAAACCATGCTCTCGGTGACTGTTTGAGACCATACAAAGATTTCTTCAATCTCAACACTTTTC[C/A]
TTTAGTTTGTGAGGTAGCAAATCCAGGTGGGATATCCATATACCTCTTCCTGAAGGTCTCCATGTAAAAAGGCATTCTTGACATCTAGCTGATGCAATGG

Reverse complement sequence

CCATTGCATCAGCTAGATGTCAAGAATGCCTTTTTACATGGAGACCTTCAGGAAGAGGTATATGGATATCCCACCTGGATTTGCTACCTCACAAACTAAA[G/T]
GAAAAGTGTTGAGATTGAAGAAATCTTTGTATGGTCTCAAACAGTCACCGAGAGCATGGTTTGATCGTTTTAGACGTGCAATGTGTGGTATGGGCTATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 9.40% 0.08% 1.14% NA
All Indica  2759 84.10% 14.00% 0.11% 1.88% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 79.90% 19.00% 0.37% 0.74% NA
Indica I  595 76.50% 20.50% 0.34% 2.69% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 79.50% 18.90% 0.00% 1.53% NA
Indica Intermediate  786 86.30% 10.90% 0.13% 2.67% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724796245 C -> DEL N N silent_mutation Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0724796245 C -> A LOC_Os07g41390.1 upstream_gene_variant ; 4287.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0724796245 C -> A LOC_Os07g41370.1 downstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0724796245 C -> A LOC_Os07g41370.2 downstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0724796245 C -> A LOC_Os07g41380.1 intron_variant ; MODIFIER silent_mutation Average:56.279; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724796245 NA 1.10E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 1.13E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 7.80E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 7.88E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 4.41E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 1.15E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 1.18E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 2.82E-10 mr1627 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 3.88E-06 mr1653 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 9.25E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 4.54E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 6.79E-07 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 6.04E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 6.28E-09 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 8.03E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 3.59E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 9.57E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 3.68E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 4.07E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 4.88E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 9.10E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 4.18E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724796245 NA 1.08E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251