\
| Variant ID: vg0724771428 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24771428 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 127. )
AACCTCAAAATCACCTCTAAATTTAAAATTGAAAATTCAAATTTTAGCTGATAAGTATAAGCATAAGCGAGAAAAGATGAAGCCCTTGATTTTTTTTTAT[G/A]
GACGGAAGAAGTAGTACTGAAAATGAAAGACGCTCATTGCTCACCCTGGATATAAACTAACTAAAATTACCGATTTGATCAGGTAAGTACTCTGTCAGCA
TGCTGACAGAGTACTTACCTGATCAAATCGGTAATTTTAGTTAGTTTATATCCAGGGTGAGCAATGAGCGTCTTTCATTTTCAGTACTACTTCTTCCGTC[C/T]
ATAAAAAAAAATCAAGGGCTTCATCTTTTCTCGCTTATGCTTATACTTATCAGCTAAAATTTGAATTTTCAATTTTAAATTTAGAGGTGATTTTGAGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 25.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 46.80% | 53.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 25.70% | 74.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.20% | 89.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.70% | 12.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724771428 | G -> A | LOC_Os07g41360.1 | upstream_gene_variant ; 1848.0bp to feature; MODIFIER | silent_mutation | Average:58.875; most accessible tissue: Callus, score: 78.633 | N | N | N | N |
| vg0724771428 | G -> A | LOC_Os07g41340.1 | downstream_gene_variant ; 4714.0bp to feature; MODIFIER | silent_mutation | Average:58.875; most accessible tissue: Callus, score: 78.633 | N | N | N | N |
| vg0724771428 | G -> A | LOC_Os07g41350.1 | downstream_gene_variant ; 2264.0bp to feature; MODIFIER | silent_mutation | Average:58.875; most accessible tissue: Callus, score: 78.633 | N | N | N | N |
| vg0724771428 | G -> A | LOC_Os07g41350-LOC_Os07g41360 | intergenic_region ; MODIFIER | silent_mutation | Average:58.875; most accessible tissue: Callus, score: 78.633 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724771428 | NA | 1.76E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724771428 | NA | 6.85E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724771428 | NA | 2.20E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 7.92E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 1.87E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 8.45E-13 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 6.25E-08 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 4.11E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | 5.58E-06 | 5.59E-06 | mr1899 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 9.29E-09 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | 1.23E-06 | NA | mr1932 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 5.91E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 1.28E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 2.41E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 3.19E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 2.06E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 7.11E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 1.10E-06 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 2.09E-06 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 1.44E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 7.16E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 8.92E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 3.65E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 9.78E-13 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 6.20E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | 2.46E-07 | 4.38E-12 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 6.55E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 3.51E-12 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 1.54E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 7.87E-11 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724771428 | NA | 4.05E-10 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |