\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724771428:

Variant ID: vg0724771428 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24771428
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.28, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTCAAAATCACCTCTAAATTTAAAATTGAAAATTCAAATTTTAGCTGATAAGTATAAGCATAAGCGAGAAAAGATGAAGCCCTTGATTTTTTTTTAT[G/A]
GACGGAAGAAGTAGTACTGAAAATGAAAGACGCTCATTGCTCACCCTGGATATAAACTAACTAAAATTACCGATTTGATCAGGTAAGTACTCTGTCAGCA

Reverse complement sequence

TGCTGACAGAGTACTTACCTGATCAAATCGGTAATTTTAGTTAGTTTATATCCAGGGTGAGCAATGAGCGTCTTTCATTTTCAGTACTACTTCTTCCGTC[C/T]
ATAAAAAAAAATCAAGGGCTTCATCTTTTCTCGCTTATGCTTATACTTATCAGCTAAAATTTGAATTTTCAATTTTAAATTTAGAGGTGATTTTGAGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.90% 0.08% 0.00% NA
All Indica  2759 95.60% 4.30% 0.11% 0.00% NA
All Japonica  1512 46.80% 53.10% 0.07% 0.00% NA
Aus  269 25.70% 74.30% 0.00% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 96.60% 3.20% 0.22% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 10.20% 89.80% 0.00% 0.00% NA
Tropical Japonica  504 87.70% 12.10% 0.20% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724771428 G -> A LOC_Os07g41360.1 upstream_gene_variant ; 1848.0bp to feature; MODIFIER silent_mutation Average:58.875; most accessible tissue: Callus, score: 78.633 N N N N
vg0724771428 G -> A LOC_Os07g41340.1 downstream_gene_variant ; 4714.0bp to feature; MODIFIER silent_mutation Average:58.875; most accessible tissue: Callus, score: 78.633 N N N N
vg0724771428 G -> A LOC_Os07g41350.1 downstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:58.875; most accessible tissue: Callus, score: 78.633 N N N N
vg0724771428 G -> A LOC_Os07g41350-LOC_Os07g41360 intergenic_region ; MODIFIER silent_mutation Average:58.875; most accessible tissue: Callus, score: 78.633 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724771428 NA 1.76E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724771428 NA 6.85E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724771428 NA 2.20E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 7.92E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 1.87E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 8.45E-13 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 6.25E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 4.11E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 5.58E-06 5.59E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 9.29E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 1.23E-06 NA mr1932 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 5.91E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 1.28E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 2.41E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 3.19E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 2.06E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 7.11E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 1.10E-06 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 2.09E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 1.44E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 7.16E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 8.92E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 3.65E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 9.78E-13 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 6.20E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 2.46E-07 4.38E-12 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 6.55E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 3.51E-12 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 1.54E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 7.87E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724771428 NA 4.05E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251