Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724768460:

Variant ID: vg0724768460 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 24768460
Reference Allele: T	Alternative Allele: TC,C
Primary Allele: TC	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGTTTCATCGATAAATATACTTTTATGTGTACATATAGTTTTACATATTTTACAAAAGTTTTTGGATAAGATGGATGATCAAACATATTTAAAAAAAT[T/TC,C]
AACGTTGTCAAATATTTAGAGACGAAGGGAGTAACTAATTACATACATTTCCTCTTGATTAACTATTCGATTTGTAGATAGACAGATGCAGCAGAATCAA

Reverse complement sequence

TTGATTCTGCTGCATCTGTCTATCTACAAATCGAATAGTTAATCAAGAGGAAATGTATGTAATTAGTTACTCCCTTCGTCTCTAAATATTTGACAACGTT[A/GA,G]
ATTTTTTTAAATATGTTTGATCATCCATCTTATCCAAAAACTTTTGTAAAATATGTAAAACTATATGTACACATAAAAGTATATTTATCGATGAAACAAA

Allele Frequencies:

Populations	Population Size	Frequency of TC(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	31.90%	0.47%	0.00%	T: 23.68%
All Indica	2759	73.00%	15.80%	0.69%	0.00%	T: 10.44%
All Japonica	1512	0.20%	53.00%	0.07%	0.00%	T: 46.69%
Aus	269	5.60%	74.00%	0.00%	0.00%	T: 20.45%
Indica I	595	71.10%	1.00%	0.67%	0.00%	T: 27.23%
Indica II	465	86.50%	8.40%	1.51%	0.00%	T: 3.66%
Indica III	913	68.60%	30.40%	0.11%	0.00%	T: 0.88%
Indica Intermediate	786	71.80%	14.50%	0.89%	0.00%	T: 12.85%
Temperate Japonica	767	0.30%	21.80%	0.00%	0.00%	T: 77.97%
Tropical Japonica	504	0.00%	87.90%	0.20%	0.00%	T: 11.90%
Japonica Intermediate	241	0.40%	79.70%	0.00%	0.00%	T: 19.92%
VI/Aromatic	96	22.90%	28.10%	0.00%	0.00%	T: 48.96%
Intermediate	90	25.60%	46.70%	2.22%	0.00%	T: 25.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724768460	T -> TC	LOC_Os07g41330.1	upstream_gene_variant ; 4913.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> TC	LOC_Os07g41360.1	upstream_gene_variant ; 4815.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> TC	LOC_Os07g41340.1	downstream_gene_variant ; 1747.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> TC	LOC_Os07g41350.1	intron_variant ; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> C	LOC_Os07g41330.1	upstream_gene_variant ; 4912.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> C	LOC_Os07g41360.1	upstream_gene_variant ; 4816.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> C	LOC_Os07g41340.1	downstream_gene_variant ; 1746.0bp to feature; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N
vg0724768460	T -> C	LOC_Os07g41350.1	intron_variant ; MODIFIER	silent_mutation	Average:67.218; most accessible tissue: Callus, score: 87.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724768460	NA	2.64E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	8.15E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	2.81E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	6.29E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	7.17E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	5.36E-11	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	1.03E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	2.41E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	2.34E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	1.14E-11	mr1973	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	2.07E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	4.04E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	6.70E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	2.98E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	9.75E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	4.38E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	3.24E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	1.07E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	8.09E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	5.09E-11	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460	NA	4.05E-13	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251