\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724768460:

Variant ID: vg0724768460 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24768460
Reference Allele: TAlternative Allele: TC,C
Primary Allele: TCSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTTCATCGATAAATATACTTTTATGTGTACATATAGTTTTACATATTTTACAAAAGTTTTTGGATAAGATGGATGATCAAACATATTTAAAAAAAT[T/TC,C]
AACGTTGTCAAATATTTAGAGACGAAGGGAGTAACTAATTACATACATTTCCTCTTGATTAACTATTCGATTTGTAGATAGACAGATGCAGCAGAATCAA

Reverse complement sequence

TTGATTCTGCTGCATCTGTCTATCTACAAATCGAATAGTTAATCAAGAGGAAATGTATGTAATTAGTTACTCCCTTCGTCTCTAAATATTTGACAACGTT[A/GA,G]
ATTTTTTTAAATATGTTTGATCATCCATCTTATCCAAAAACTTTTGTAAAATATGTAAAACTATATGTACACATAAAAGTATATTTATCGATGAAACAAA

Allele Frequencies:

Populations Population SizeFrequency of TC(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 31.90% 0.47% 0.00% T: 23.68%
All Indica  2759 73.00% 15.80% 0.69% 0.00% T: 10.44%
All Japonica  1512 0.20% 53.00% 0.07% 0.00% T: 46.69%
Aus  269 5.60% 74.00% 0.00% 0.00% T: 20.45%
Indica I  595 71.10% 1.00% 0.67% 0.00% T: 27.23%
Indica II  465 86.50% 8.40% 1.51% 0.00% T: 3.66%
Indica III  913 68.60% 30.40% 0.11% 0.00% T: 0.88%
Indica Intermediate  786 71.80% 14.50% 0.89% 0.00% T: 12.85%
Temperate Japonica  767 0.30% 21.80% 0.00% 0.00% T: 77.97%
Tropical Japonica  504 0.00% 87.90% 0.20% 0.00% T: 11.90%
Japonica Intermediate  241 0.40% 79.70% 0.00% 0.00% T: 19.92%
VI/Aromatic  96 22.90% 28.10% 0.00% 0.00% T: 48.96%
Intermediate  90 25.60% 46.70% 2.22% 0.00% T: 25.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724768460 T -> TC LOC_Os07g41330.1 upstream_gene_variant ; 4913.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> TC LOC_Os07g41360.1 upstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> TC LOC_Os07g41340.1 downstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> TC LOC_Os07g41350.1 intron_variant ; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> C LOC_Os07g41330.1 upstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> C LOC_Os07g41360.1 upstream_gene_variant ; 4816.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> C LOC_Os07g41340.1 downstream_gene_variant ; 1746.0bp to feature; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N
vg0724768460 T -> C LOC_Os07g41350.1 intron_variant ; MODIFIER silent_mutation Average:67.218; most accessible tissue: Callus, score: 87.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724768460 NA 2.64E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 8.15E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 2.81E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 6.29E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 7.17E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 5.36E-11 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 1.03E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 2.41E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 2.34E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 1.14E-11 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 2.07E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 4.04E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 6.70E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 2.98E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 9.75E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 4.38E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 3.24E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 1.07E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 8.09E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 5.09E-11 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724768460 NA 4.05E-13 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251