\
| Variant ID: vg0724707548 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 24707548 |
| Reference Allele: ACT | Alternative Allele: GCT,A |
| Primary Allele: ACT | Secondary Allele: GCT |
Inferred Ancestral Allele: Not determined.
CCATTTACTCTTATAGCTTATTGTACGTAGCCAAAATTTAAATTTTTAAATTTATTTTTGGGTTTTGTTCCATCGTACTTTACTTTTTTTTTCAACATTT[ACT/GCT,A]
TTTAAACCACAAATAACACACTATAACATCATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATGATGTTATAGTGTGTTATTTGTGGTTTAAA[AGT/AGC,T]
AAATGTTGAAAAAAAAAGTAAAGTACGATGGAACAAAACCCAAAAATAAATTTAAAAATTTAAATTTTGGCTACGTACAATAAGCTATAAGAGTAAATGG
| Populations | Population Size | Frequency of ACT(primary allele) | Frequency of GCT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.40% | 3.20% | 9.42% | 62.80% | A: 0.23% |
| All Indica | 2759 | 9.60% | 4.20% | 11.53% | 74.66% | A: 0.04% |
| All Japonica | 1512 | 48.60% | 1.40% | 4.89% | 44.51% | A: 0.60% |
| Aus | 269 | 42.00% | 2.60% | 11.52% | 43.87% | NA |
| Indica I | 595 | 25.50% | 2.90% | 8.24% | 63.36% | NA |
| Indica II | 465 | 2.80% | 1.70% | 10.97% | 84.52% | NA |
| Indica III | 913 | 2.20% | 6.80% | 14.68% | 76.34% | NA |
| Indica Intermediate | 786 | 10.10% | 3.70% | 10.69% | 75.45% | A: 0.13% |
| Temperate Japonica | 767 | 90.00% | 0.30% | 1.96% | 7.82% | NA |
| Tropical Japonica | 504 | 2.00% | 3.40% | 7.74% | 85.71% | A: 1.19% |
| Japonica Intermediate | 241 | 14.50% | 0.80% | 8.30% | 75.10% | A: 1.24% |
| VI/Aromatic | 96 | 15.60% | 2.10% | 11.46% | 70.83% | NA |
| Intermediate | 90 | 27.80% | 4.40% | 12.22% | 54.44% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724707548 | ACT -> A | LOC_Os07g41230.1 | downstream_gene_variant ; 3755.0bp to feature; MODIFIER | silent_mutation | Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0724707548 | ACT -> A | LOC_Os07g41230-LOC_Os07g41240 | intergenic_region ; MODIFIER | silent_mutation | Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0724707548 | ACT -> DEL | N | N | silent_mutation | Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0724707548 | ACT -> GCT | LOC_Os07g41230.1 | downstream_gene_variant ; 3754.0bp to feature; MODIFIER | silent_mutation | Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0724707548 | ACT -> GCT | LOC_Os07g41230-LOC_Os07g41240 | intergenic_region ; MODIFIER | silent_mutation | Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724707548 | NA | 4.82E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724707548 | NA | 4.51E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 9.01E-11 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 3.99E-13 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 5.89E-10 | mr1570 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 4.79E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 3.80E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 8.14E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 2.15E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 5.34E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 1.17E-07 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 1.47E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 1.91E-10 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 4.83E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | 1.12E-06 | 1.12E-10 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 5.84E-11 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 1.11E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 2.54E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724707548 | NA | 2.41E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |