\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724707548:

Variant ID: vg0724707548 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24707548
Reference Allele: ACTAlternative Allele: GCT,A
Primary Allele: ACTSecondary Allele: GCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATTTACTCTTATAGCTTATTGTACGTAGCCAAAATTTAAATTTTTAAATTTATTTTTGGGTTTTGTTCCATCGTACTTTACTTTTTTTTTCAACATTT[ACT/GCT,A]
TTTAAACCACAAATAACACACTATAACATCATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Reverse complement sequence

ATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATGATGTTATAGTGTGTTATTTGTGGTTTAAA[AGT/AGC,T]
AAATGTTGAAAAAAAAAGTAAAGTACGATGGAACAAAACCCAAAAATAAATTTAAAAATTTAAATTTTGGCTACGTACAATAAGCTATAAGAGTAAATGG

Allele Frequencies:

Populations Population SizeFrequency of ACT(primary allele) Frequency of GCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 3.20% 9.42% 62.80% A: 0.23%
All Indica  2759 9.60% 4.20% 11.53% 74.66% A: 0.04%
All Japonica  1512 48.60% 1.40% 4.89% 44.51% A: 0.60%
Aus  269 42.00% 2.60% 11.52% 43.87% NA
Indica I  595 25.50% 2.90% 8.24% 63.36% NA
Indica II  465 2.80% 1.70% 10.97% 84.52% NA
Indica III  913 2.20% 6.80% 14.68% 76.34% NA
Indica Intermediate  786 10.10% 3.70% 10.69% 75.45% A: 0.13%
Temperate Japonica  767 90.00% 0.30% 1.96% 7.82% NA
Tropical Japonica  504 2.00% 3.40% 7.74% 85.71% A: 1.19%
Japonica Intermediate  241 14.50% 0.80% 8.30% 75.10% A: 1.24%
VI/Aromatic  96 15.60% 2.10% 11.46% 70.83% NA
Intermediate  90 27.80% 4.40% 12.22% 54.44% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724707548 ACT -> A LOC_Os07g41230.1 downstream_gene_variant ; 3755.0bp to feature; MODIFIER silent_mutation Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0724707548 ACT -> A LOC_Os07g41230-LOC_Os07g41240 intergenic_region ; MODIFIER silent_mutation Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0724707548 ACT -> DEL N N silent_mutation Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0724707548 ACT -> GCT LOC_Os07g41230.1 downstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0724707548 ACT -> GCT LOC_Os07g41230-LOC_Os07g41240 intergenic_region ; MODIFIER silent_mutation Average:23.629; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724707548 NA 4.82E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724707548 NA 4.51E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 9.01E-11 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 3.99E-13 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 5.89E-10 mr1570 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 4.79E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 3.80E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 8.14E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 2.15E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 5.34E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 1.17E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 1.47E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 1.91E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 4.83E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 1.12E-06 1.12E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 5.84E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 1.11E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 2.54E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724707548 NA 2.41E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251