\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724677672:

Variant ID: vg0724677672 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 24677672
Reference Allele: AAlternative Allele: G,AGG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATACACTTCTATAAAAAAAAGTAGTAGTGGTGATGAGTGGTGAATCTGTCACCACTCTCACAACCAACTCCCTACTTTTTGGAAAAAAATATACAT[A/G,AGG]
TAGAGGCAGAGGGTCTACATGTCAACCACTCCCACTACCAACTCCCTACTTTTTATGGAAATGAAAAAAAATTAACACTCTAGGAACCCGAGCTTCCACA

Reverse complement sequence

TGTGGAAGCTCGGGTTCCTAGAGTGTTAATTTTTTTTCATTTCCATAAAAAGTAGGGAGTTGGTAGTGGGAGTGGTTGACATGTAGACCCTCTGCCTCTA[T/C,CCT]
ATGTATATTTTTTTCCAAAAAGTAGGGAGTTGGTTGTGAGAGTGGTGACAGATTCACCACTCATCACCACTACTACTTTTTTTTATAGAAGTGTATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 35.00% 0.17% 0.28% AGG: 2.31%
All Indica  2759 88.80% 9.40% 0.18% 0.11% AGG: 1.49%
All Japonica  1512 17.50% 81.30% 0.13% 0.40% AGG: 0.66%
Aus  269 50.20% 37.20% 0.00% 0.00% AGG: 12.64%
Indica I  595 71.90% 25.00% 0.17% 0.17% AGG: 2.69%
Indica II  465 89.00% 10.10% 0.22% 0.22% AGG: 0.43%
Indica III  913 98.50% 1.20% 0.11% 0.00% AGG: 0.22%
Indica Intermediate  786 90.20% 6.70% 0.25% 0.13% AGG: 2.67%
Temperate Japonica  767 32.30% 67.10% 0.26% 0.13% AGG: 0.13%
Tropical Japonica  504 0.20% 98.00% 0.00% 0.40% AGG: 1.39%
Japonica Intermediate  241 6.60% 91.30% 0.00% 1.24% AGG: 0.83%
VI/Aromatic  96 59.40% 16.70% 0.00% 0.00% AGG: 23.96%
Intermediate  90 41.10% 52.20% 1.11% 4.44% AGG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724677672 A -> DEL N N silent_mutation Average:53.323; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0724677672 A -> G LOC_Os07g41210.1 downstream_gene_variant ; 4756.0bp to feature; MODIFIER silent_mutation Average:53.323; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0724677672 A -> G LOC_Os07g41200-LOC_Os07g41210 intergenic_region ; MODIFIER silent_mutation Average:53.323; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0724677672 A -> AGG LOC_Os07g41210.1 downstream_gene_variant ; 4755.0bp to feature; MODIFIER silent_mutation Average:53.323; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0724677672 A -> AGG LOC_Os07g41200-LOC_Os07g41210 intergenic_region ; MODIFIER silent_mutation Average:53.323; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724677672 A AGG 0.19 0.08 0.02 0.08 0.06 0.04
vg0724677672 A G -0.01 0.0 0.0 -0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724677672 NA 5.32E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 1.22E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 1.07E-08 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 4.37E-15 mr1330_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 1.81E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 8.37E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 1.02E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724677672 NA 8.80E-17 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251