\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724669663:

Variant ID: vg0724669663 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24669663
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCACCTCTCCCTACCACGGCCACAATACCATATTGTCCAACCCGCTGCGGCTCGGCCGCAACGGGGGTATATGGTTTCGATTAGGTTCCTCTTGACGG[G/C]
TTTGGATTACGTTCTGGCTGCTGCGTTCGTTTCTCCAACGAGAGATGAAATTTTGGATAGCTAAACGGCGTTTTTGGTGTGAATACTTTCTATATGAAAG

Reverse complement sequence

CTTTCATATAGAAAGTATTCACACCAAAAACGCCGTTTAGCTATCCAAAATTTCATCTCTCGTTGGAGAAACGAACGCAGCAGCCAGAACGTAATCCAAA[C/G]
CCGTCAAGAGGAACCTAATCGAAACCATATACCCCCGTTGCGGCCGAGCCGCAGCGGGTTGGACAATATGGTATTGTGGCCGTGGTAGGGAGAGGTGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 23.00% 0.40% 0.08% NA
All Indica  2759 95.50% 4.20% 0.18% 0.07% NA
All Japonica  1512 36.80% 62.40% 0.79% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 91.60% 8.20% 0.00% 0.22% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 7.50% 0.51% 0.13% NA
Temperate Japonica  767 66.40% 32.90% 0.78% 0.00% NA
Tropical Japonica  504 1.20% 98.20% 0.40% 0.20% NA
Japonica Intermediate  241 17.00% 81.30% 1.66% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724669663 G -> DEL N N silent_mutation Average:89.523; most accessible tissue: Zhenshan97 panicle, score: 98.511 N N N N
vg0724669663 G -> C LOC_Os07g41200.1 upstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:89.523; most accessible tissue: Zhenshan97 panicle, score: 98.511 N N N N
vg0724669663 G -> C LOC_Os07g41200-LOC_Os07g41210 intergenic_region ; MODIFIER silent_mutation Average:89.523; most accessible tissue: Zhenshan97 panicle, score: 98.511 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724669663 G C -0.05 -0.03 -0.03 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724669663 NA 4.88E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724669663 NA 8.80E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 2.07E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 7.84E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 3.01E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 3.54E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 8.86E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 4.31E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 4.18E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 5.63E-07 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 6.77E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 1.06E-17 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 6.25E-07 2.34E-10 mr1354_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 2.48E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 3.90E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 1.31E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 1.14E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 9.93E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 4.50E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 5.03E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 9.50E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 3.03E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 5.39E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 2.72E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724669663 NA 8.33E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251