\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724648364:

Variant ID: vg0724648364 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24648364
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGTTTGTGATTGAATGAGTAGTGGAGGCAGGTAGGAAAAATGAATGGAGTGTTGTGATTGGTTGGGAAGAAAATATTGTTGGAGAAGTTGTTACATTTT[A/G]
AGATAAATTCTAAGAGTTAAAAGTTGTTATATTTTAGAACGGAGAGAGCAGATTATTCGCTCTACTCTTCGGAAAATATGCCTTTTTCATCTACTGATGA

Reverse complement sequence

TCATCAGTAGATGAAAAAGGCATATTTTCCGAAGAGTAGAGCGAATAATCTGCTCTCTCCGTTCTAAAATATAACAACTTTTAACTCTTAGAATTTATCT[T/C]
AAAATGTAACAACTTCTCCAACAATATTTTCTTCCCAACCAATCACAACACTCCATTCATTTTTCCTACCTGCCTCCACTACTCATTCAATCACAAACCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 32.40% 0.66% 0.34% NA
All Indica  2759 88.60% 10.90% 0.25% 0.25% NA
All Japonica  1512 35.40% 63.80% 0.46% 0.33% NA
Aus  269 31.60% 68.00% 0.37% 0.00% NA
Indica I  595 75.10% 24.40% 0.34% 0.17% NA
Indica II  465 91.00% 8.40% 0.00% 0.65% NA
Indica III  913 97.30% 2.50% 0.11% 0.11% NA
Indica Intermediate  786 87.40% 11.80% 0.51% 0.25% NA
Temperate Japonica  767 64.90% 34.20% 0.78% 0.13% NA
Tropical Japonica  504 1.00% 98.60% 0.00% 0.40% NA
Japonica Intermediate  241 13.70% 85.10% 0.41% 0.83% NA
VI/Aromatic  96 37.50% 49.00% 13.54% 0.00% NA
Intermediate  90 50.00% 42.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724648364 A -> DEL N N silent_mutation Average:77.816; most accessible tissue: Minghui63 root, score: 93.8 N N N N
vg0724648364 A -> G LOC_Os07g41170.1 downstream_gene_variant ; 4958.0bp to feature; MODIFIER silent_mutation Average:77.816; most accessible tissue: Minghui63 root, score: 93.8 N N N N
vg0724648364 A -> G LOC_Os07g41170-LOC_Os07g41180 intergenic_region ; MODIFIER silent_mutation Average:77.816; most accessible tissue: Minghui63 root, score: 93.8 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724648364 A G -0.02 0.0 0.0 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724648364 NA 1.27E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724648364 NA 1.14E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.57E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 1.84E-06 7.76E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 9.75E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 2.21E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 5.79E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.43E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 7.31E-12 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.57E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 9.47E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.34E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 5.47E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 8.33E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 5.13E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 3.04E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 6.92E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.28E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 7.92E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.86E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 2.04E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 5.78E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 4.98E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 1.01E-06 1.00E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 4.39E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 6.77E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 4.19E-07 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 1.40E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724648364 NA 6.49E-09 mr1992_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251