Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724610432:

Variant ID: vg0724610432 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24610432
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CATTGTTCAATTGTGGTCTGATGTAGCTCATTTCCTAGGTGGAAGTTCAACTTAACAGTCTCCACCTAAACCCTGGTATATCAAACAGGCACAACATTGA[A/G]
AACATTTCTTATGAGCCTTGAAATTTGGTGGGGATTGTTATAATAATTGGGCTAGACCCAATATATTCTATTAAATCTCAAAGGCCCATAATAAGTGTTA

Reverse complement sequence

TAACACTTATTATGGGCCTTTGAGATTTAATAGAATATATTGGGTCTAGCCCAATTATTATAACAATCCCCACCAAATTTCAAGGCTCATAAGAAATGTT[T/C]
TCAATGTTGTGCCTGTTTGATATACCAGGGTTTAGGTGGAGACTGTTAAGTTGAACTTCCACCTAGGAAATGAGCTACATCAGACCACAATTGAACAATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	11.20%	0.06%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.11%	0.00%	NA
All Japonica	1512	69.60%	30.40%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.00%	2.80%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.90%	0.25%	0.00%	NA
Temperate Japonica	767	44.50%	55.50%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	11.20%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724610432	A -> G	LOC_Os07g41110.1	downstream_gene_variant ; 1199.0bp to feature; MODIFIER	silent_mutation	Average:33.657; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0724610432	A -> G	LOC_Os07g41120.1	intron_variant ; MODIFIER	silent_mutation	Average:33.657; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724610432	3.77E-07	2.30E-10	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	6.34E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	8.30E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	1.64E-12	6.16E-17	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	6.65E-08	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	2.29E-08	2.75E-18	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	9.09E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	7.84E-07	6.32E-16	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.32E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.29E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.17E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.11E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.76E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.27E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	3.87E-06	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	4.60E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	5.95E-09	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	8.82E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.09E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	6.69E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	3.04E-06	NA	mr1506_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.54E-07	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	9.20E-06	1.54E-09	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.33E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	9.80E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.87E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	4.53E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.82E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.10E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.74E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.39E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	2.90E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	1.31E-15	2.18E-21	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.47E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	3.57E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.25E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	4.07E-07	1.72E-17	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	2.89E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.24E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	4.36E-06	mr1870_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.71E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	9.26E-16	2.36E-30	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	NA	1.66E-10	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724610432	6.61E-06	NA	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251