\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724575067:

Variant ID: vg0724575067 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24575067
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCGTTCCAACGAAATAGCTAATGTATACTAACATTAGCAAAACATCAGCACAATATCGTAGATACTAGATAGATATCGGATCTGATACCTCCTACCA[G/A,C]
ACATGATGCCATATAAGTACCAGATTTGGTACTTAGGTACCACGATGACATCGGCTATTCATTATAAAGGTATATACCGTTATGTAGAATTTCTTTAAAG

Reverse complement sequence

CTTTAAAGAAATTCTACATAACGGTATATACCTTTATAATGAATAGCCGATGTCATCGTGGTACCTAAGTACCAAATCTGGTACTTATATGGCATCATGT[C/T,G]
TGGTAGGAGGTATCAGATCCGATATCTATCTAGTATCTACGATATTGTGCTGATGTTTTGCTAATGTTAGTATACATTAGCTATTTCGTTGGAACGATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 6.50% 0.91% 0.32% C: 0.04%
All Indica  2759 99.30% 0.50% 0.11% 0.00% C: 0.04%
All Japonica  1512 79.70% 16.70% 2.58% 0.99% NA
Aus  269 98.50% 1.10% 0.00% 0.00% C: 0.37%
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 1.50% 0.65% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 68.20% 31.00% 0.78% 0.00% NA
Tropical Japonica  504 92.50% 0.40% 4.56% 2.58% NA
Japonica Intermediate  241 89.60% 5.40% 4.15% 0.83% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724575067 G -> DEL N N silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> A LOC_Os07g41070.1 upstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> A LOC_Os07g41080.1 downstream_gene_variant ; 95.0bp to feature; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> A LOC_Os07g41070-LOC_Os07g41080 intergenic_region ; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> C LOC_Os07g41070.1 upstream_gene_variant ; 4749.0bp to feature; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> C LOC_Os07g41080.1 downstream_gene_variant ; 95.0bp to feature; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N
vg0724575067 G -> C LOC_Os07g41070-LOC_Os07g41080 intergenic_region ; MODIFIER silent_mutation Average:48.147; most accessible tissue: Callus, score: 91.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724575067 NA 3.08E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724575067 7.65E-09 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 7.18E-10 9.43E-13 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.86E-19 1.54E-20 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 2.01E-13 2.01E-13 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 6.28E-29 1.96E-25 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 9.37E-20 8.34E-28 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.01E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 6.07E-33 9.03E-35 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 3.75E-17 1.07E-22 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 4.56E-09 2.25E-17 mr1842 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.56E-20 2.47E-27 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 2.62E-12 1.16E-15 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 NA 7.02E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 2.54E-07 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 6.99E-10 4.14E-12 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 7.86E-06 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.10E-09 NA mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.58E-09 1.58E-09 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 6.07E-07 NA mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.46E-43 9.98E-32 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 2.74E-35 1.39E-42 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.53E-14 6.77E-19 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 8.51E-10 3.01E-13 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 NA 4.94E-07 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 3.25E-15 5.21E-24 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 7.96E-08 9.70E-10 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 NA 2.41E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.60E-10 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 2.73E-09 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 4.90E-07 NA mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.67E-06 1.67E-06 mr1714_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 5.01E-44 4.99E-45 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.73E-22 1.16E-30 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.01E-10 4.12E-21 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.14E-41 7.69E-53 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724575067 1.89E-21 1.22E-30 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251