\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724571945:

Variant ID: vg0724571945 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24571945
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.10, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AACGTTTCAAGCGAAAACTCAAAATCTCTTGTACTGTGGGACGGAGGGAGTAGCAGCTAGCGTGGCGGGGGCGCGGGTGTTGTCGCGGCAGAGACTGTTT[G/A]
GTTGCTACCGTGAGCTACTTGCCTGAGGAAAAGTGGCGCCTGAGAGTTCCCTGAAATTTTGGTGCTTGTTGCCTGATGGGGCATCCTTGAGTTGGTTGTT

Reverse complement sequence

AACAACCAACTCAAGGATGCCCCATCAGGCAACAAGCACCAAAATTTCAGGGAACTCTCAGGCGCCACTTTTCCTCAGGCAAGTAGCTCACGGTAGCAAC[C/T]
AAACAGTCTCTGCCGCGACAACACCCGCGCCCCCGCCACGCTAGCTGCTACTCCCTCCGTCCCACAGTACAAGAGATTTTGAGTTTTCGCTTGAAACGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 18.30% 0.06% 17.22% NA
All Indica  2759 95.70% 2.50% 0.00% 1.74% NA
All Japonica  1512 1.90% 48.90% 0.07% 49.14% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 89.00% 3.00% 0.00% 7.96% NA
Indica III  913 99.60% 0.20% 0.00% 0.22% NA
Indica Intermediate  786 93.50% 5.30% 0.00% 1.15% NA
Temperate Japonica  767 0.90% 90.20% 0.00% 8.87% NA
Tropical Japonica  504 1.20% 1.40% 0.20% 97.22% NA
Japonica Intermediate  241 6.20% 17.00% 0.00% 76.76% NA
VI/Aromatic  96 65.60% 32.30% 0.00% 2.08% NA
Intermediate  90 52.20% 22.20% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724571945 G -> DEL N N silent_mutation Average:67.078; most accessible tissue: Callus, score: 93.562 N N N N
vg0724571945 G -> A LOC_Os07g41070.1 upstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:67.078; most accessible tissue: Callus, score: 93.562 N N N N
vg0724571945 G -> A LOC_Os07g41080.1 downstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:67.078; most accessible tissue: Callus, score: 93.562 N N N N
vg0724571945 G -> A LOC_Os07g41070-LOC_Os07g41080 intergenic_region ; MODIFIER silent_mutation Average:67.078; most accessible tissue: Callus, score: 93.562 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724571945 G A -0.08 -0.04 -0.03 -0.06 -0.1 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724571945 NA 7.35E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724571945 NA 3.26E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 3.92E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 2.97E-15 mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 6.27E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 4.17E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.82E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 9.23E-16 mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 8.50E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 4.59E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 2.17E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 5.89E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.22E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 3.85E-15 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 6.78E-15 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.70E-10 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 8.42E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 2.60E-14 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 5.86E-07 1.86E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 2.38E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 3.38E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 5.16E-13 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.36E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 5.57E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 3.93E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 4.83E-08 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.61E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 6.44E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 9.71E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.49E-13 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 1.51E-07 3.56E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 2.26E-07 7.76E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724571945 NA 1.90E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251