\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724533734:

Variant ID: vg0724533734 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24533734
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTTGCAACAAACATTGTCACATTGAGGATGCCTTAAGAGATTTTGCTTATTTAACCATATGTAACTGTATGGGCAAAACATATTATATTTTGGGA[T/C]
GGAGCTAGTATTAACTATAACGATAAGACAACGTTAGGGTGACTAGATGCATGTTTCCTCTGAAAACAGCTGACTCCCTGTTTCTCACTCTTCCCCAATG

Reverse complement sequence

CATTGGGGAAGAGTGAGAAACAGGGAGTCAGCTGTTTTCAGAGGAAACATGCATCTAGTCACCCTAACGTTGTCTTATCGTTATAGTTAATACTAGCTCC[A/G]
TCCCAAAATATAATATGTTTTGCCCATACAGTTACATATGGTTAAATAAGCAAAATCTCTTAAGGCATCCTCAATGTGACAATGTTTGTTGCAAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 11.80% 4.89% 8.46% NA
All Indica  2759 96.40% 2.00% 0.25% 1.30% NA
All Japonica  1512 30.10% 32.40% 14.35% 23.15% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 91.20% 1.70% 1.29% 5.81% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 94.10% 4.70% 0.13% 1.02% NA
Temperate Japonica  767 36.60% 59.30% 1.83% 2.22% NA
Tropical Japonica  504 14.90% 1.00% 29.37% 54.76% NA
Japonica Intermediate  241 41.10% 12.40% 22.82% 23.65% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 65.60% 13.30% 6.67% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724533734 T -> DEL N N silent_mutation Average:39.756; most accessible tissue: Callus, score: 86.19 N N N N
vg0724533734 T -> C LOC_Os07g41000.1 upstream_gene_variant ; 1388.0bp to feature; MODIFIER silent_mutation Average:39.756; most accessible tissue: Callus, score: 86.19 N N N N
vg0724533734 T -> C LOC_Os07g41014.1 downstream_gene_variant ; 640.0bp to feature; MODIFIER silent_mutation Average:39.756; most accessible tissue: Callus, score: 86.19 N N N N
vg0724533734 T -> C LOC_Os07g41000-LOC_Os07g41014 intergenic_region ; MODIFIER silent_mutation Average:39.756; most accessible tissue: Callus, score: 86.19 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724533734 9.05E-06 NA mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 2.29E-09 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 1.84E-07 1.84E-07 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 6.25E-14 3.15E-12 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 7.58E-10 1.20E-08 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 1.68E-11 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 1.66E-11 5.93E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 6.54E-08 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 5.32E-08 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 7.08E-06 NA mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 6.51E-07 NA mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 2.12E-28 2.01E-16 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 3.76E-21 3.06E-10 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 6.71E-06 NA mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 1.52E-08 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 6.60E-16 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 3.55E-11 3.15E-08 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 4.56E-15 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734 2.38E-11 9.39E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251