Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724533734:

Variant ID: vg0724533734 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24533734
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTTTTGCAACAAACATTGTCACATTGAGGATGCCTTAAGAGATTTTGCTTATTTAACCATATGTAACTGTATGGGCAAAACATATTATATTTTGGGA[T/C]
GGAGCTAGTATTAACTATAACGATAAGACAACGTTAGGGTGACTAGATGCATGTTTCCTCTGAAAACAGCTGACTCCCTGTTTCTCACTCTTCCCCAATG

Reverse complement sequence

CATTGGGGAAGAGTGAGAAACAGGGAGTCAGCTGTTTTCAGAGGAAACATGCATCTAGTCACCCTAACGTTGTCTTATCGTTATAGTTAATACTAGCTCC[A/G]
TCCCAAAATATAATATGTTTTGCCCATACAGTTACATATGGTTAAATAAGCAAAATCTCTTAAGGCATCCTCAATGTGACAATGTTTGTTGCAAAAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	11.80%	4.89%	8.46%	NA
All Indica	2759	96.40%	2.00%	0.25%	1.30%	NA
All Japonica	1512	30.10%	32.40%	14.35%	23.15%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	91.20%	1.70%	1.29%	5.81%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	94.10%	4.70%	0.13%	1.02%	NA
Temperate Japonica	767	36.60%	59.30%	1.83%	2.22%	NA
Tropical Japonica	504	14.90%	1.00%	29.37%	54.76%	NA
Japonica Intermediate	241	41.10%	12.40%	22.82%	23.65%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	65.60%	13.30%	6.67%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724533734	T -> DEL	N	N	silent_mutation	Average:39.756; most accessible tissue: Callus, score: 86.19	N	N	N	N
vg0724533734	T -> C	LOC_Os07g41000.1	upstream_gene_variant ; 1388.0bp to feature; MODIFIER	silent_mutation	Average:39.756; most accessible tissue: Callus, score: 86.19	N	N	N	N
vg0724533734	T -> C	LOC_Os07g41014.1	downstream_gene_variant ; 640.0bp to feature; MODIFIER	silent_mutation	Average:39.756; most accessible tissue: Callus, score: 86.19	N	N	N	N
vg0724533734	T -> C	LOC_Os07g41000-LOC_Os07g41014	intergenic_region ; MODIFIER	silent_mutation	Average:39.756; most accessible tissue: Callus, score: 86.19	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724533734	9.05E-06	NA	mr1138	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	2.29E-09	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	1.84E-07	1.84E-07	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	6.25E-14	3.15E-12	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	7.58E-10	1.20E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	1.68E-11	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	1.66E-11	5.93E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	6.54E-08	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	5.32E-08	NA	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	7.08E-06	NA	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	6.51E-07	NA	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	2.12E-28	2.01E-16	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	3.76E-21	3.06E-10	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	6.71E-06	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	1.52E-08	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	6.60E-16	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	3.55E-11	3.15E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	4.56E-15	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533734	2.38E-11	9.39E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251