\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724533303:

Variant ID: vg0724533303 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24533303
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTTCATATTTTTTGAGTGTACTGTAGCAAATTTTGCCTTTTATTTTTGATAGGCATATTTCAATCCAACAACCTATCCTCTTAATAACTTTCTCGGA[T/C]
TCAATGCGTCACTCTCCATTCTTCCACACAAGATTGGCTATATGGGCATCGAGAAATGTAATAATTAATTAATCGTTTGTTTACGAGGAATAACTAGTAG

Reverse complement sequence

CTACTAGTTATTCCTCGTAAACAAACGATTAATTAATTATTACATTTCTCGATGCCCATATAGCCAATCTTGTGTGGAAGAATGGAGAGTGACGCATTGA[A/G]
TCCGAGAAAGTTATTAAGAGGATAGGTTGTTGGATTGAAATATGCCTATCAAAAATAAAAGGCAAAATTTGCTACAGTACACTCAAAAAATATGAAATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.60% 0.40% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 90.50% 8.30% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 1.00% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.30% 0.26% 0.00% NA
Tropical Japonica  504 76.00% 21.00% 2.98% 0.00% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724533303 T -> C LOC_Os07g41000.1 upstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:22.088; most accessible tissue: Callus, score: 48.034 N N N N
vg0724533303 T -> C LOC_Os07g41014.1 downstream_gene_variant ; 1071.0bp to feature; MODIFIER silent_mutation Average:22.088; most accessible tissue: Callus, score: 48.034 N N N N
vg0724533303 T -> C LOC_Os07g41000-LOC_Os07g41014 intergenic_region ; MODIFIER silent_mutation Average:22.088; most accessible tissue: Callus, score: 48.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724533303 NA 4.50E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724533303 1.28E-06 NA mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533303 NA 2.11E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533303 2.74E-08 NA mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724533303 4.00E-06 NA mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251