Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724530317:

Variant ID: vg0724530317 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24530317
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTTCTCATTGCCGGTCATCAACATAAGAGACTATAAGCCAACTATAAACTTATATGAAGAAGAGAGAAGTATAAAAATGAAGAGAGTTAGCTCTCA[C/T]
GTAAGAGTGAGCTATTCACACATTTCAAAATAAATGTATTTATAATACATAGGTGAGAGAAAGATATAGAAGAGAAAAAAAACTTAGACACAATCTTATA

Reverse complement sequence

TATAAGATTGTGTCTAAGTTTTTTTTCTCTTCTATATCTTTCTCTCACCTATGTATTATAAATACATTTATTTTGAAATGTGTGAATAGCTCACTCTTAC[G/A]
TGAGAGCTAACTCTCTTCATTTTTATACTTCTCTCTTCTTCATATAAGTTTATAGTTGGCTTATAGTCTCTTATGTTGATGACCGGCAATGAGAAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	14.30%	0.00%	0.00%	NA
All Indica	2759	97.70%	2.30%	0.00%	0.00%	NA
All Japonica	1512	60.30%	39.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.50%	0.00%	0.00%	NA
Temperate Japonica	767	35.10%	64.90%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724530317	C -> T	LOC_Os07g40986.1	upstream_gene_variant ; 2322.0bp to feature; MODIFIER	silent_mutation	Average:49.512; most accessible tissue: Callus, score: 82.938	N	N	N	N
vg0724530317	C -> T	LOC_Os07g40986.2	upstream_gene_variant ; 2322.0bp to feature; MODIFIER	silent_mutation	Average:49.512; most accessible tissue: Callus, score: 82.938	N	N	N	N
vg0724530317	C -> T	LOC_Os07g41000.1	downstream_gene_variant ; 1826.0bp to feature; MODIFIER	silent_mutation	Average:49.512; most accessible tissue: Callus, score: 82.938	N	N	N	N
vg0724530317	C -> T	LOC_Os07g41014.1	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:49.512; most accessible tissue: Callus, score: 82.938	N	N	N	N
vg0724530317	C -> T	LOC_Os07g40986-LOC_Os07g41000	intergenic_region ; MODIFIER	silent_mutation	Average:49.512; most accessible tissue: Callus, score: 82.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724530317	1.86E-08	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	3.14E-18	1.36E-14	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	8.55E-15	1.01E-09	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	9.79E-13	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.32E-11	2.24E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	2.28E-06	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	3.25E-06	NA	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	3.74E-12	NA	mr1181_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.97E-34	1.68E-19	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	7.36E-26	2.15E-11	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	NA	1.79E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.60E-07	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	2.10E-06	NA	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	3.92E-09	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.20E-06	NA	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	NA	9.21E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	NA	2.26E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	NA	9.48E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	6.28E-21	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	2.01E-15	1.05E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.14E-19	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724530317	1.84E-15	1.95E-09	mr1902_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251