\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724529647:

Variant ID: vg0724529647 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24529647
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, T: 0.15, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GTATCTTCTATGTATCATCATCTGTATATTTGTCATGTCTGTATATATACATGGATTCATATTTAGATATAGATACAGATATGGAGATATCTAAATCTAA[A/T]
TCTCTATCTATGTCTACGTCTACTTCCTGATGGTATCCTTTGAAGAAGAGTGGCATGCCTCATATAGCCAGTTAATTATAGGAAGAATCTATAAAATATT

Reverse complement sequence

AATATTTTATAGATTCTTCCTATAATTAACTGGCTATATGAGGCATGCCACTCTTCTTCAAAGGATACCATCAGGAAGTAGACGTAGACATAGATAGAGA[T/A]
TTAGATTTAGATATCTCCATATCTGTATCTATATCTAAATATGAATCCATGTATATATACAGACATGACAAATATACAGATGATGATACATAGAAGATAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 29.50% 0.04% 0.34% NA
All Indica  2759 96.00% 3.70% 0.07% 0.22% NA
All Japonica  1512 16.90% 82.80% 0.00% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.00% 0.17% NA
Indica II  465 89.90% 9.50% 0.00% 0.65% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 5.70% 0.13% 0.25% NA
Temperate Japonica  767 30.20% 69.60% 0.00% 0.13% NA
Tropical Japonica  504 0.40% 99.20% 0.00% 0.40% NA
Japonica Intermediate  241 8.70% 90.50% 0.00% 0.83% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 54.40% 40.00% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724529647 A -> DEL N N silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0724529647 A -> T LOC_Os07g40986.1 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0724529647 A -> T LOC_Os07g40986.2 upstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0724529647 A -> T LOC_Os07g41000.1 downstream_gene_variant ; 2496.0bp to feature; MODIFIER silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0724529647 A -> T LOC_Os07g41014.1 downstream_gene_variant ; 4727.0bp to feature; MODIFIER silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N
vg0724529647 A -> T LOC_Os07g40986-LOC_Os07g41000 intergenic_region ; MODIFIER silent_mutation Average:29.354; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724529647 NA 1.54E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724529647 4.43E-09 1.16E-15 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 7.07E-10 9.47E-13 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.70E-06 7.99E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 2.26E-12 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 6.76E-14 6.76E-14 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 2.42E-30 1.21E-24 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.25E-23 1.92E-30 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 5.62E-07 7.36E-06 mr1406 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.90E-06 NA mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 4.14E-06 1.23E-08 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 3.58E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.66E-19 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 5.76E-19 1.24E-23 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.38E-12 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.45E-11 3.59E-14 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 7.41E-07 2.26E-36 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.12E-08 4.48E-15 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.24E-11 4.30E-14 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.66E-06 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 8.94E-15 6.43E-45 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.78E-08 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.71E-10 3.70E-10 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 8.55E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 5.60E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 9.45E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 6.61E-17 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.84E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 3.91E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 3.95E-09 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.86E-54 4.39E-36 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.18E-06 2.19E-08 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 5.71E-42 5.43E-50 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 3.73E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 5.28E-07 6.20E-07 mr1406_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.54E-06 3.54E-06 mr1406_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.11E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 8.02E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 5.29E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 4.66E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.03E-08 1.05E-06 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.58E-08 1.45E-11 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 9.94E-08 3.62E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 4.52E-06 1.34E-08 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 2.67E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 9.61E-12 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 7.02E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 9.18E-11 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.79E-08 1.63E-10 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.29E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.24E-18 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 4.07E-07 5.11E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 1.80E-08 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.23E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 1.41E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.87E-06 3.87E-06 mr1714_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 4.86E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 3.17E-29 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 2.13E-24 1.08E-31 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 4.77E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 2.22E-28 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 2.22E-23 1.73E-32 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724529647 NA 4.22E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251