Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724523127:

Variant ID: vg0724523127 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24523127
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCTTTGTGGTGCCTCTTTGTGAGAAGGATTTGAGAAGGGAAAAGAGTTGGATTGAGTGATTGAGAAGTTGAGAGCTAGTGAGCTTCACTCCATACTTT[A/G]
AGCACTCGAGTTCATAGCAAGCAAATCTTCGATTGTGTTTGTTACTCTTGGGGACTAAGGTCTCCTAGACGGCTAGGCGTTGCCGGTGAGCACCCAAGGT

Reverse complement sequence

ACCTTGGGTGCTCACCGGCAACGCCTAGCCGTCTAGGAGACCTTAGTCCCCAAGAGTAACAAACACAATCGAAGATTTGCTTGCTATGAACTCGAGTGCT[T/C]
AAAGTATGGAGTGAAGCTCACTAGCTCTCAACTTCTCAATCACTCAATCCAACTCTTTTCCCTTCTCAAATCCTTCTCACAAAGAGGCACCACAAAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.50%	15.70%	24.31%	40.50%	NA
All Indica	2759	10.40%	2.10%	32.44%	55.13%	NA
All Japonica	1512	39.90%	43.40%	0.66%	16.07%	NA
Aus	269	4.50%	0.00%	64.31%	31.23%	NA
Indica I	595	7.20%	0.20%	35.46%	57.14%	NA
Indica II	465	11.80%	8.60%	32.04%	47.53%	NA
Indica III	913	8.00%	0.30%	30.78%	60.90%	NA
Indica Intermediate	786	14.60%	1.70%	32.32%	51.40%	NA
Temperate Japonica	767	65.20%	5.00%	0.39%	29.47%	NA
Tropical Japonica	504	4.40%	95.20%	0.00%	0.40%	NA
Japonica Intermediate	241	33.60%	57.30%	2.90%	6.22%	NA
VI/Aromatic	96	1.00%	4.20%	55.21%	39.58%	NA
Intermediate	90	22.20%	26.70%	20.00%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724523127	A -> DEL	N	N	silent_mutation	Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0724523127	A -> G	LOC_Os07g40986.1	intron_variant ; MODIFIER	silent_mutation	Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0724523127	A -> G	LOC_Os07g40986.2	intron_variant ; MODIFIER	silent_mutation	Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724523127	3.63E-07	1.33E-08	mr1354	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	2.10E-13	1.60E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	1.25E-08	NA	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	1.89E-09	NA	mr1354_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	5.17E-19	9.36E-09	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	8.25E-06	NA	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	1.23E-08	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	4.42E-11	5.50E-08	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	3.02E-07	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724523127	3.14E-09	2.56E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251