\
| Variant ID: vg0724523127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24523127 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 200. )
ATCCTTTGTGGTGCCTCTTTGTGAGAAGGATTTGAGAAGGGAAAAGAGTTGGATTGAGTGATTGAGAAGTTGAGAGCTAGTGAGCTTCACTCCATACTTT[A/G]
AGCACTCGAGTTCATAGCAAGCAAATCTTCGATTGTGTTTGTTACTCTTGGGGACTAAGGTCTCCTAGACGGCTAGGCGTTGCCGGTGAGCACCCAAGGT
ACCTTGGGTGCTCACCGGCAACGCCTAGCCGTCTAGGAGACCTTAGTCCCCAAGAGTAACAAACACAATCGAAGATTTGCTTGCTATGAACTCGAGTGCT[T/C]
AAAGTATGGAGTGAAGCTCACTAGCTCTCAACTTCTCAATCACTCAATCCAACTCTTTTCCCTTCTCAAATCCTTCTCACAAAGAGGCACCACAAAGGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 19.50% | 15.70% | 24.31% | 40.50% | NA |
| All Indica | 2759 | 10.40% | 2.10% | 32.44% | 55.13% | NA |
| All Japonica | 1512 | 39.90% | 43.40% | 0.66% | 16.07% | NA |
| Aus | 269 | 4.50% | 0.00% | 64.31% | 31.23% | NA |
| Indica I | 595 | 7.20% | 0.20% | 35.46% | 57.14% | NA |
| Indica II | 465 | 11.80% | 8.60% | 32.04% | 47.53% | NA |
| Indica III | 913 | 8.00% | 0.30% | 30.78% | 60.90% | NA |
| Indica Intermediate | 786 | 14.60% | 1.70% | 32.32% | 51.40% | NA |
| Temperate Japonica | 767 | 65.20% | 5.00% | 0.39% | 29.47% | NA |
| Tropical Japonica | 504 | 4.40% | 95.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 33.60% | 57.30% | 2.90% | 6.22% | NA |
| VI/Aromatic | 96 | 1.00% | 4.20% | 55.21% | 39.58% | NA |
| Intermediate | 90 | 22.20% | 26.70% | 20.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724523127 | A -> DEL | N | N | silent_mutation | Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0724523127 | A -> G | LOC_Os07g40986.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0724523127 | A -> G | LOC_Os07g40986.2 | intron_variant ; MODIFIER | silent_mutation | Average:13.525; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724523127 | 3.63E-07 | 1.33E-08 | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 2.10E-13 | 1.60E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 1.25E-08 | NA | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 1.89E-09 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 5.17E-19 | 9.36E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 8.25E-06 | NA | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 1.23E-08 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 4.42E-11 | 5.50E-08 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 3.02E-07 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724523127 | 3.14E-09 | 2.56E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |