\
| Variant ID: vg0724506609 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24506609 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 113. )
AAATGATTCACCACCCAAGTCACTTCAATTCTTGTTTTTTTTTTTTCACGAATGCGCAAAAGGATTGCACGTCAATATATTACTTCCTCCGTTTCACAAT[A/G]
TAAGTCATTCTATTATTTCCCATATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTCATTAGCATCAATATGAATATGGAAAATGC
GCATTTTCCATATTCATATTGATGCTAATGAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATATGGGAAATAATAGAATGACTTA[T/C]
ATTGTGAAACGGAGGAAGTAATATATTGACGTGCAATCCTTTTGCGCATTCGTGAAAAAAAAAAAACAAGAATTGAAGTGACTTGGGTGGTGAATCATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 29.70% | 0.36% | 0.87% | NA |
| All Indica | 2759 | 94.20% | 3.90% | 0.40% | 1.45% | NA |
| All Japonica | 1512 | 16.90% | 82.90% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.50% | 1.80% | 0.67% | 1.01% | NA |
| Indica II | 465 | 88.40% | 9.70% | 0.65% | 1.29% | NA |
| Indica III | 913 | 97.40% | 0.40% | 0.22% | 1.97% | NA |
| Indica Intermediate | 786 | 92.40% | 6.10% | 0.25% | 1.27% | NA |
| Temperate Japonica | 767 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 90.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724506609 | A -> DEL | N | N | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0724506609 | A -> G | LOC_Os07g40940.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724506609 | NA | 4.76E-12 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0724506609 | 2.07E-07 | 1.22E-15 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.69E-10 | 4.14E-13 | mr1138 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.48E-11 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.45E-14 | 2.45E-14 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 5.05E-28 | 1.95E-26 | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 3.23E-26 | 5.28E-34 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 3.71E-08 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.34E-09 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.39E-18 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 3.12E-20 | 3.38E-25 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.71E-12 | NA | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 4.83E-12 | 1.05E-14 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 6.56E-06 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.36E-06 | 1.47E-14 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 4.99E-11 | 2.49E-13 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.59E-07 | NA | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.02E-13 | 2.79E-42 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.05E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.52E-10 | 1.52E-10 | mr1181_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 4.84E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.58E-43 | 2.03E-35 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 8.10E-07 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.61E-44 | 1.72E-53 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.25E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 4.47E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 2.54E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.15E-08 | 4.65E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 5.94E-10 | 2.36E-13 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 9.63E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 4.14E-08 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.29E-11 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.44E-11 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 2.13E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.60E-09 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.29E-07 | 1.30E-09 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 4.90E-16 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.39E-06 | NA | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 5.65E-09 | NA | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.24E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 1.50E-13 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 6.49E-07 | 6.49E-07 | mr1714_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 6.71E-12 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.86E-28 | 1.74E-08 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 1.98E-26 | 1.29E-34 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 4.24E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 2.37E-26 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | 3.28E-25 | 4.90E-35 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724506609 | NA | 2.15E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |