Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724506609:

Variant ID: vg0724506609 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24506609
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGATTCACCACCCAAGTCACTTCAATTCTTGTTTTTTTTTTTTCACGAATGCGCAAAAGGATTGCACGTCAATATATTACTTCCTCCGTTTCACAAT[A/G]
TAAGTCATTCTATTATTTCCCATATTCATATTGATGTTAATGAATCTAGATAGATATATATGTCTAGATTCATTAGCATCAATATGAATATGGAAAATGC

Reverse complement sequence

GCATTTTCCATATTCATATTGATGCTAATGAATCTAGACATATATATCTATCTAGATTCATTAACATCAATATGAATATGGGAAATAATAGAATGACTTA[T/C]
ATTGTGAAACGGAGGAAGTAATATATTGACGTGCAATCCTTTTGCGCATTCGTGAAAAAAAAAAAACAAGAATTGAAGTGACTTGGGTGGTGAATCATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 29.70% 0.36% 0.87% NA
All Indica  2759 94.20% 3.90% 0.40% 1.45% NA
All Japonica  1512 16.90% 82.90% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 96.50% 1.80% 0.67% 1.01% NA
Indica II  465 88.40% 9.70% 0.65% 1.29% NA
Indica III  913 97.40% 0.40% 0.22% 1.97% NA
Indica Intermediate  786 92.40% 6.10% 0.25% 1.27% NA
Temperate Japonica  767 30.20% 69.80% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.40% 0.20% 0.00% NA
Japonica Intermediate  241 8.70% 90.50% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724506609 A -> DEL N N silent_mutation Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0724506609 A -> G LOC_Os07g40940.1 intron_variant ; MODIFIER silent_mutation Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724506609 NA 4.76E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724506609 2.07E-07 1.22E-15 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.69E-10 4.14E-13 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.48E-11 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.45E-14 2.45E-14 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 5.05E-28 1.95E-26 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 3.23E-26 5.28E-34 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 3.71E-08 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.34E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.39E-18 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 3.12E-20 3.38E-25 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.71E-12 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 4.83E-12 1.05E-14 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 6.56E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.36E-06 1.47E-14 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 4.99E-11 2.49E-13 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.59E-07 NA mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.02E-13 2.79E-42 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.05E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.52E-10 1.52E-10 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 4.84E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.58E-43 2.03E-35 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 8.10E-07 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.61E-44 1.72E-53 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.25E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 4.47E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 2.54E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.15E-08 4.65E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 5.94E-10 2.36E-13 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 9.63E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 4.14E-08 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.29E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.44E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 2.13E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.60E-09 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.29E-07 1.30E-09 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 4.90E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.39E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 5.65E-09 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.24E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 1.50E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 6.49E-07 6.49E-07 mr1714_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 6.71E-12 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.86E-28 1.74E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 1.98E-26 1.29E-34 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 4.24E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 2.37E-26 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 3.28E-25 4.90E-35 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724506609 NA 2.15E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251