\
| Variant ID: vg0724502952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24502952 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTATAAGGGTCTCCAGATGCAAGAAGCACCCAAACAATCCAGATTTTTACCCAGACTCGAAAATGCTGGGTAGGTGTAAAATCTAGAAAATAAACTAGAA[G/A]
CAAGAAGCTGAGTAGCTTCTTCGCATTAACATCATACTTACATGTCTAGTTCGAACCTCAATGTTCGAAACTCTTTTCCTCAGCAAAAAGAAAAAAATGA
TCATTTTTTTCTTTTTGCTGAGGAAAAGAGTTTCGAACATTGAGGTTCGAACTAGACATGTAAGTATGATGTTAATGCGAAGAAGCTACTCAGCTTCTTG[C/T]
TTCTAGTTTATTTTCTAGATTTTACACCTACCCAGCATTTTCGAGTCTGGGTAAAAATCTGGATTGTTTGGGTGCTTCTTGCATCTGGAGACCCTTATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.10% | 7.30% | 0.17% | 0.51% | NA |
| All Indica | 2759 | 98.80% | 1.10% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 98.00% | 1.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 16.70% | 77.00% | 0.74% | 5.58% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 2.80% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 72.90% | 4.17% | 2.08% | NA |
| Intermediate | 90 | 87.80% | 8.90% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724502952 | G -> DEL | N | N | silent_mutation | Average:54.018; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0724502952 | G -> A | LOC_Os07g40940.1 | upstream_gene_variant ; 2214.0bp to feature; MODIFIER | silent_mutation | Average:54.018; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0724502952 | G -> A | LOC_Os07g40930-LOC_Os07g40940 | intergenic_region ; MODIFIER | silent_mutation | Average:54.018; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724502952 | NA | 1.71E-12 | mr1231 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | 5.35E-06 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 1.44E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 6.32E-39 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 4.54E-47 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 1.44E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | 5.37E-08 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 1.08E-06 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 7.15E-09 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 8.97E-49 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 1.48E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | NA | 2.48E-26 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | 3.49E-13 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | 2.14E-11 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724502952 | 7.70E-07 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |