Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724500741:

Variant ID: vg0724500741 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24500741
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTGAGTAGTCTGCCACATTGGCGCCACGTGTGCTAGTACTAAGTCAAAACCGCTCATAACAGTGTTAGGGGGGTAATTTGTCCGGTATTGAAAGTTCA[G/A]
GGTGAGTAATATCTGGTTTTCGGGTTCAGGGGGAAATTCGGCCGACCGCGATAGTTCAGGGGGGTAATTCGTACTTTTTCCTATCATATATCCATATGCT

Reverse complement sequence

AGCATATGGATATATGATAGGAAAAAGTACGAATTACCCCCCTGAACTATCGCGGTCGGCCGAATTTCCCCCTGAACCCGAAAACCAGATATTACTCACC[C/T]
TGAACTTTCAATACCGGACAAATTACCCCCCTAACACTGTTATGAGCGGTTTTGACTTAGTACTAGCACACGTGGCGCCAATGTGGCAGACTACTCAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 10.90% 0.74% 10.14% NA
All Indica  2759 98.90% 0.30% 0.11% 0.69% NA
All Japonica  1512 37.60% 32.30% 1.46% 28.70% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 0.90% 0.65% 3.23% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.30% 0.00% 0.51% NA
Temperate Japonica  767 63.20% 2.60% 0.78% 33.38% NA
Tropical Japonica  504 7.50% 66.50% 2.78% 23.21% NA
Japonica Intermediate  241 18.70% 55.20% 0.83% 25.31% NA
VI/Aromatic  96 62.50% 10.40% 9.38% 17.71% NA
Intermediate  90 78.90% 10.00% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724500741 G -> DEL N N silent_mutation Average:97.841; most accessible tissue: Minghui63 panicle, score: 99.406 N N N N
vg0724500741 G -> A LOC_Os07g40930.1 upstream_gene_variant ; 3165.0bp to feature; MODIFIER silent_mutation Average:97.841; most accessible tissue: Minghui63 panicle, score: 99.406 N N N N
vg0724500741 G -> A LOC_Os07g40940.1 upstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:97.841; most accessible tissue: Minghui63 panicle, score: 99.406 N N N N
vg0724500741 G -> A LOC_Os07g40930-LOC_Os07g40940 intergenic_region ; MODIFIER silent_mutation Average:97.841; most accessible tissue: Minghui63 panicle, score: 99.406 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724500741 G A -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724500741 4.03E-07 NA mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 5.17E-12 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 4.69E-12 5.65E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 NA 1.35E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 NA 4.88E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 1.88E-11 NA mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 4.31E-10 NA mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 1.99E-06 NA mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 1.90E-06 NA mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 1.10E-21 NA mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 9.14E-22 6.48E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 1.35E-06 NA mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 NA 1.17E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 2.44E-07 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 NA 1.03E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 4.50E-15 1.47E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 4.66E-11 NA mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 8.61E-14 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724500741 4.13E-11 NA mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251