Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0724487049:

Variant ID: vg0724487049 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24487049
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTACGATGGTTGAGCACTTCCTTCCTCCATCCCACAGAGCTGGTCGTTCTGCTGTTCAAAATTTGTTCCGTAAAATTTGTCATCCTAGCATCGATCTT[G/C]
ACCAGCGAACTGGGCATCAAGTCAATTCCATTTGAATTTGGCTAATGATTACTCTTTCTCTGTACAACAGTGCCACTACTTACCATGTGATAGATAATAG

Reverse complement sequence

CTATTATCTATCACATGGTAAGTAGTGGCACTGTTGTACAGAGAAAGAGTAATCATTAGCCAAATTCAAATGGAATTGACTTGATGCCCAGTTCGCTGGT[C/G]
AAGATCGATGCTAGGATGACAAATTTTACGGAACAAATTTTGAACAGCAGAACGACCAGCTCTGTGGGATGGAGGAAGGAAGTGCTCAACCATCGTACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.30%	30.50%	0.04%	0.15%	NA
All Indica	2759	96.60%	3.40%	0.00%	0.00%	NA
All Japonica	1512	33.70%	65.80%	0.07%	0.46%	NA
Aus	269	17.10%	82.90%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	90.30%	9.70%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.70%	0.00%	0.00%	NA
Temperate Japonica	767	60.50%	39.40%	0.00%	0.13%	NA
Tropical Japonica	504	1.80%	96.80%	0.20%	1.19%	NA
Japonica Intermediate	241	14.90%	85.10%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724487049	G -> DEL	N	N	silent_mutation	Average:66.219; most accessible tissue: Callus, score: 86.325	N	N	N	N
vg0724487049	G -> C	LOC_Os07g40900.1	upstream_gene_variant ; 2126.0bp to feature; MODIFIER	silent_mutation	Average:66.219; most accessible tissue: Callus, score: 86.325	N	N	N	N
vg0724487049	G -> C	LOC_Os07g40920.1	upstream_gene_variant ; 3927.0bp to feature; MODIFIER	silent_mutation	Average:66.219; most accessible tissue: Callus, score: 86.325	N	N	N	N
vg0724487049	G -> C	LOC_Os07g40910.1	downstream_gene_variant ; 768.0bp to feature; MODIFIER	silent_mutation	Average:66.219; most accessible tissue: Callus, score: 86.325	N	N	N	N
vg0724487049	G -> C	LOC_Os07g40900-LOC_Os07g40910	intergenic_region ; MODIFIER	silent_mutation	Average:66.219; most accessible tissue: Callus, score: 86.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724487049	NA	2.14E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	1.76E-10	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	5.12E-06	NA	mr1138	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	2.12E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	6.58E-07	NA	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	1.22E-16	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	6.56E-16	3.41E-09	mr1354	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	7.53E-19	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	6.39E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	5.25E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	1.31E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	6.49E-10	NA	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	2.26E-12	NA	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	4.31E-06	NA	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	5.61E-08	NA	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	1.60E-13	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	2.90E-16	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	2.48E-23	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	4.81E-23	5.18E-08	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	2.85E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	3.14E-06	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	4.75E-06	NA	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	5.72E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	9.33E-07	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	2.31E-06	NA	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	1.46E-10	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	NA	2.99E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	1.84E-14	NA	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	3.16E-13	3.12E-07	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	2.80E-14	NA	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724487049	2.61E-13	5.96E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251