\
| Variant ID: vg0724481626 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 24481626 |
| Reference Allele: G | Alternative Allele: GGCAGTTCAGGCACCTTCGGCAGCTCCGGCACTTCC |
| Primary Allele: G | Secondary Allele: GGCAGTTCAGGCACCTTCGG CAGCTCCGGCACTTCC |
Inferred Ancestral Allele: Not determined.
GCGGCAGCTCGACCTTGGGCAACGATGGCAGCTCAGGCTTCGGGAGCTCCGGCACCGCAGGGTGCTCAGGCAATTCAGGCTTCGGCAATTCCGGCACCTC[G/GGCAGTTCAGGCACCTTCGGCAGCTCCGGCACTTCC]
GGGTGTGGCAGTTCAGGCACCTTCGGAAACTCCGGCACGGCGGCGCCATGCGGCAGCTCGGGCTTTGGCAGCTCCGGCACGGCGAGGTGCGGCGGCAGCT
AGCTGCCGCCGCACCTCGCCGTGCCGGAGCTGCCAAAGCCCGAGCTGCCGCATGGCGCCGCCGTGCCGGAGTTTCCGAAGGTGCCTGAACTGCCACACCC[C/GGAAGTGCCGGAGCTGCCGAAGGTGCCTGAACTGCC]
GAGGTGCCGGAATTGCCGAAGCCTGAATTGCCTGAGCACCCTGCGGTGCCGGAGCTCCCGAAGCCTGAGCTGCCATCGTTGCCCAAGGTCGAGCTGCCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GGCAGTTCAGGCACCTTCGG CAGCTCCGGCACTTCC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 1.00% | 1.08% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 95.60% | 1.80% | 2.58% | 0.00% | NA |
| Aus | 269 | 97.40% | 1.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 0.10% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 5.20% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724481626 | G -> GGCAGTTCAGGCACCTTCGGCAGCTCCGGC ACTTCC | LOC_Os07g40890.1 | frameshift_variant ; p.Pro89fs; HIGH | frameshift_variant | Average:75.352; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724481626 | NA | 1.68E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 2.84E-08 | NA | mr1343 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 5.85E-06 | 5.86E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 6.55E-17 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 7.74E-14 | 5.70E-09 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 1.67E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 6.79E-11 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 3.75E-11 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 6.19E-12 | 6.38E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 4.26E-07 | NA | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 5.02E-08 | NA | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 6.19E-13 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 1.27E-15 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 3.93E-26 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 9.27E-24 | 7.93E-09 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 3.02E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | NA | 1.47E-14 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 6.67E-07 | NA | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 3.83E-06 | NA | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 3.51E-06 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 2.60E-17 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 1.61E-14 | 4.14E-08 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 1.06E-15 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724481626 | 2.09E-13 | 3.00E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |