\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724465712:

Variant ID: vg0724465712 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24465712
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGATCTTTAAGTTAATTAATGAATAGGGAGTGTGGCAGAATTTGTTGAGGAAAAAATACTTGGTAAGGAAATCCATTTTTCAGGTCCAAAAACAACCG[G/A,T]
GGGATTCTCATTTTTGGGCTAGCCTTATGGCAGCAAAAGAACCCTTCCAGACACTTGGCCACTTCACAGTGAATAATGGGAAACAAGTAAGATTCTGGGA

Reverse complement sequence

TCCCAGAATCTTACTTGTTTCCCATTATTCACTGTGAAGTGGCCAAGTGTCTGGAAGGGTTCTTTTGCTGCCATAAGGCTAGCCCAAAAATGAGAATCCC[C/T,A]
CGGTTGTTTTTGGACCTGAAAAATGGATTTCCTTACCAAGTATTTTTTCCTCAACAAATTCTGCCACACTCCCTATTCATTAATTAACTTAAAGATCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 18.20% 1.76% 2.41% T: 0.04%
All Indica  2759 97.10% 1.40% 0.62% 0.91% NA
All Japonica  1512 53.80% 38.60% 3.11% 4.56% NA
Aus  269 17.80% 73.20% 2.97% 5.95% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 91.40% 3.90% 1.94% 2.80% NA
Indica III  913 99.10% 0.10% 0.44% 0.33% NA
Indica Intermediate  786 95.90% 2.50% 0.51% 1.02% NA
Temperate Japonica  767 82.70% 4.60% 4.17% 8.60% NA
Tropical Japonica  504 11.10% 87.90% 0.99% 0.00% NA
Japonica Intermediate  241 51.00% 43.60% 4.15% 1.24% NA
VI/Aromatic  96 72.90% 15.60% 9.38% 2.08% NA
Intermediate  90 63.30% 30.00% 2.22% 2.22% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724465712 G -> DEL N N silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> A LOC_Os07g40820.1 upstream_gene_variant ; 3276.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> A LOC_Os07g40830.1 downstream_gene_variant ; 987.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> A LOC_Os07g40840.1 downstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> A LOC_Os07g40850.1 downstream_gene_variant ; 4392.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> A LOC_Os07g40820-LOC_Os07g40830 intergenic_region ; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> T LOC_Os07g40820.1 upstream_gene_variant ; 3276.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> T LOC_Os07g40830.1 downstream_gene_variant ; 987.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> T LOC_Os07g40840.1 downstream_gene_variant ; 3033.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> T LOC_Os07g40850.1 downstream_gene_variant ; 4392.0bp to feature; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0724465712 G -> T LOC_Os07g40820-LOC_Os07g40830 intergenic_region ; MODIFIER silent_mutation Average:65.945; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724465712 NA 2.15E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.27E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.29E-12 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 3.34E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.31E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 4.11E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 9.18E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.14E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.93E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 3.45E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.23E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 7.40E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 3.38E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 7.40E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.04E-13 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 9.65E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.54E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 9.48E-07 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 6.11E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.37E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.40E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.36E-19 mr1047_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.62E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 6.96E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.23E-21 mr1189_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.26E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 7.18E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 3.34E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.44E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.89E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.93E-09 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.14E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.85E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 7.01E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.08E-08 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.94E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 3.20E-12 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.54E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.35E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 4.41E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.83E-20 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 5.27E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 8.82E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.55E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 7.17E-15 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.09E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 2.91E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 8.40E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 4.21E-12 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.59E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 4.66E-12 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 9.43E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 1.71E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 6.09E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724465712 NA 6.25E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251