\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724435404:

Variant ID: vg0724435404 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24435404
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTTATTATTTTTGTTACAATTTGTAGAAGTTGAATTTTAACTTGCATGTTTGTGGATTGATATATTACATATTAACCTATCTTGTTCATATTTTTT[T/A]
AATTTTTTTTATAACCATTTAGATGACATGCAATAAACTGGTGGACGTCCACTCGAGCTGTTAAAATAGTGTCCCGGATTATCACTGCACACATCCCAAT

Reverse complement sequence

ATTGGGATGTGTGCAGTGATAATCCGGGACACTATTTTAACAGCTCGAGTGGACGTCCACCAGTTTATTGCATGTCATCTAAATGGTTATAAAAAAAATT[A/T]
AAAAAATATGAACAAGATAGGTTAATATGTAATATATCAATCCACAAACATGCAAGTTAAAATTCAACTTCTACAAATTGTAACAAAAATAATAAACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.90% 6.80% 8.13% 54.21% NA
All Indica  2759 6.50% 0.40% 4.53% 88.55% NA
All Japonica  1512 80.10% 18.70% 0.79% 0.40% NA
Aus  269 5.60% 0.00% 73.98% 20.45% NA
Indica I  595 4.90% 0.20% 4.87% 90.08% NA
Indica II  465 12.30% 1.50% 1.94% 84.30% NA
Indica III  913 2.60% 0.00% 3.61% 93.76% NA
Indica Intermediate  786 8.80% 0.50% 6.87% 83.84% NA
Temperate Japonica  767 66.90% 31.90% 0.78% 0.39% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 13.70% 2.49% 1.24% NA
VI/Aromatic  96 7.30% 19.80% 39.58% 33.33% NA
Intermediate  90 52.20% 7.80% 11.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724435404 T -> DEL N N silent_mutation Average:27.672; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0724435404 T -> A LOC_Os07g40770.1 upstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:27.672; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0724435404 T -> A LOC_Os07g40780.1 upstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:27.672; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0724435404 T -> A LOC_Os07g40770-LOC_Os07g40780 intergenic_region ; MODIFIER silent_mutation Average:27.672; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724435404 1.63E-08 NA mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.16E-10 5.54E-14 mr1138 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 9.81E-14 4.18E-16 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 5.40E-10 5.39E-10 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.45E-23 1.98E-19 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 5.23E-17 7.25E-25 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.66E-27 7.78E-29 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.24E-14 3.79E-17 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 5.22E-12 8.15E-19 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 3.38E-07 1.13E-08 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 7.46E-06 NA mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 3.53E-09 9.92E-12 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.39E-07 NA mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.80E-07 1.80E-07 mr1181_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.99E-06 NA mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.81E-37 1.63E-24 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.20E-28 3.65E-33 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 6.97E-16 9.28E-19 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 4.79E-09 8.96E-12 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.43E-06 2.66E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 3.87E-06 5.87E-08 mr1621_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 5.37E-13 1.72E-25 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.96E-06 1.86E-10 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 NA 7.09E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 5.88E-09 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 7.34E-07 NA mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 6.06E-06 NA mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.19E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 8.24E-40 4.04E-39 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 6.39E-19 1.07E-22 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 1.47E-09 3.69E-20 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 2.79E-38 1.92E-46 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724435404 6.51E-19 8.04E-23 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251