Search for Variation information by Variation ID:
Detailed information for vg0724427868:
| Variant ID: vg0724427868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24427868 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.23, others allele: 0.00, population size: 150. )
Flanking Sequence (100 bp) in Reference Genome:
TGGCAAGTGTCCGCATTTGGTAATCAATATGTAGTGGATTTGAACAAGCACACTTGTGGGTGTAGAAAATGGGATTTAACTGGAATCCCATGTTTGCATG[T/C]
TGTTTCAGCTATTCAAGGTTTCAAGCAAAGGCCAGAGAGCTATGTTGATGACATATTGACAAAGGATGCATATGCGAGGACATATTGTGGGATGATTTAT
Reverse complement sequence
ATAAATCATCCCACAATATGTCCTCGCATATGCATCCTTTGTCAATATGTCATCAACATAGCTCTCTGGCCTTTGCTTGAAACCTTGAATAGCTGAAACA[A/G]
CATGCAAACATGGGATTCCAGTTAAATCCCATTTTCTACACCCACAAGTGTGCTTGTTCAAATCCACTACATATTGATTACCAAATGCGGACACTTGCCA
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.10% | 0.50% | 22.22% | 5.14% | NA |
| All Indica | 2759 | 98.10% | 0.00% | 1.78% | 0.11% | NA |
| All Japonica | 1512 | 35.80% | 0.10% | 48.61% | 15.48% | NA |
| Aus | 269 | 20.80% | 5.90% | 73.23% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.70% | 0.00% | 3.87% | 0.43% | NA |
| Indica III | 913 | 99.30% | 0.00% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 0.10% | 3.05% | 0.13% | NA |
| Temperate Japonica | 767 | 62.30% | 0.30% | 22.69% | 14.73% | NA |
| Tropical Japonica | 504 | 4.20% | 0.00% | 78.37% | 17.46% | NA |
| Japonica Intermediate | 241 | 17.40% | 0.00% | 68.88% | 13.69% | NA |
| VI/Aromatic | 96 | 44.80% | 3.10% | 51.04% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 22.22% | 5.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724427868 | T -> DEL | LOC_Os07g40760.1 | N | frameshift_variant | Average:10.088; most accessible tissue: Minghui63 flag leaf, score: 14.393 | N | N | N | N |
| vg0724427868 | T -> C | LOC_Os07g40760.1 | missense_variant ; p.Val993Ala; MODERATE | nonsynonymous_codon ; V993A | Average:10.088; most accessible tissue: Minghui63 flag leaf, score: 14.393 | benign  |
-0.48 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724427868 | 1.77E-11 | NA | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 5.78E-12 | 7.68E-08 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 9.60E-10 | NA | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 1.94E-07 | NA | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 4.53E-13 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 7.21E-19 | 1.52E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 5.69E-06 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 9.79E-12 | 8.42E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 1.27E-06 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427868 | 1.10E-11 | NA | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |