\
| Variant ID: vg0724427664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24427664 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.31, others allele: 0.00, population size: 186. )
AATTCAAAGATACTGGGAGCTAGAGATGAACCCATAATTACCATGGTTGAGCACATAAGGACAAAAATGATGGGTGATTTCAATAATAAGAGGGAAGGTG[T/C]
AGAAAGGGACAATTGGCAAATCCCACCAAATATATTAAAGAAGCTTGAGGCAGAGAAGAGAGAGGCAAGATATTGCAAATCTGTGTGTGCTGGTAGGGGC
GCCCCTACCAGCACACACAGATTTGCAATATCTTGCCTCTCTCTTCTCTGCCTCAAGCTTCTTTAATATATTTGGTGGGATTTGCCAATTGTCCCTTTCT[A/G]
CACCTTCCCTCTTATTATTGAAATCACCCATCATTTTTGTCCTTATGTGCTCAACCATGGTAATTATGGGTTCATCTCTAGCTCCCAGTATCTTTGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 14.90% | 2.05% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 1.90% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 55.40% | 40.20% | 4.43% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.60% | 1.90% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.30% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 3.90% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 37.90% | 61.10% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 83.50% | 7.50% | 8.93% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 41.90% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 17.80% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724427664 | T -> C | LOC_Os07g40760.1 | missense_variant ; p.Val925Ala; MODERATE | nonsynonymous_codon ; V925A | Average:9.595; most accessible tissue: Minghui63 root, score: 13.235 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724427664 | 1.29E-07 | NA | mr1138 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 8.95E-06 | NA | mr1181 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 7.68E-07 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 8.25E-20 | 6.08E-15 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 1.01E-14 | 2.26E-11 | mr1354 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 2.14E-06 | 7.72E-06 | mr1406 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | NA | 2.84E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 2.77E-10 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 1.23E-09 | 2.10E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | NA | 2.78E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | NA | 3.99E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 8.45E-09 | NA | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 1.84E-29 | 2.54E-16 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 1.33E-20 | 4.96E-11 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | NA | 3.22E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 5.01E-16 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 5.50E-11 | 1.02E-08 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 6.94E-16 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724427664 | 6.13E-11 | 3.77E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |